View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21220_low_9 (Length: 318)
Name: NF21220_low_9
Description: NF21220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21220_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 43817310 - 43817487
Alignment:
| Q |
1 |
aaggttgaatggtgactagtcatatgatatggcattgcatccgnnnnnnnngaacattgtaatgtaaataatatctcattatcgtcgtaatcgtttgnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43817310 |
aaggttgaatggtgactagtcatatgatatggcattgcatccgaaaaaaaagaacattgtaatgtaaataatatctcattatcgtcgtaatcgtttgttt |
43817409 |
T |
 |
| Q |
101 |
nnnncattacggaactaaagtggagcagacagggttaaacatgtgacatcaccatgataaggtcgacatcatttcgtc |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43817410 |
ttttcattacggaactaaagtggagcagacagggttaaacatgtgacatcaccatgataaggtcgacatcatttcgtc |
43817487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 210 - 297
Target Start/End: Original strand, 43817510 - 43817597
Alignment:
| Q |
210 |
atatatacacaaattcataccacatataggaataaacggttgagattcttgtcctaaataggaacgaatgtccatccacgtagaggtt |
297 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
43817510 |
atatatacaaaaattcataccacatataggaataaacggttgagattcttgtcctaaataggaacgaatggccatccatgtagaggtt |
43817597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University