View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21221_high_2 (Length: 490)
Name: NF21221_high_2
Description: NF21221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21221_high_2 |
 |  |
|
| [»] chr8 (34 HSPs) |
 |  |
|
| [»] chr3 (48 HSPs) |
 |  |
|
| [»] chr2 (56 HSPs) |
 |  |
|
| [»] chr7 (39 HSPs) |
 |  |
|
| [»] chr6 (34 HSPs) |
 |  |
|
| [»] chr4 (62 HSPs) |
 |  |
|
| [»] chr1 (44 HSPs) |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |
|
| [»] scaffold0983 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 41)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 27219019 - 27219282
Alignment:
| Q |
1 |
tctctagtttaaagtctagaccaaaatctatttataatcgtctgtgcatctgccattgtgannnnnnnnnnnncttccattattttgatatatcataact |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27219019 |
tctctagtttaaagtctagaccacaatctatttataatcgtctgtgcatctgccattgtgatttttttttt--cttccattattttgatatatcataact |
27219116 |
T |
 |
| Q |
101 |
tttgattgcttttagggtaagaatacatatatctaccctccccaaactctaccttacgggagccacgcgcactgggtcaccctatataatttctgattgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27219117 |
tttgattgcttttagggtaagaatacatatatctaccctccccaaactcaaccttacgggagccacgcgcactgggtcaccctatataatttctgattgc |
27219216 |
T |
 |
| Q |
201 |
ttagacacgtatttaagaattgtgcattcttcaatgtgcatggtatttgtatagagtgtgactatg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27219217 |
ttagacacgtatttaagaattgtgcattcttcaatgtgcatggtatttgtatagagtgtgactatg |
27219282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 284 - 487
Target Start/End: Complemental strand, 27219523 - 27219318
Alignment:
| Q |
284 |
ttgtggtatgatttggttgaatgtatgcgtcaaacagttttacattgtctgatacaactataacaaattaataattaatatattaagtgtaacttttaaa |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27219523 |
ttgtggtatgatttggttgaatgtatgcgtaaaacagttttacattgcctgatacaactataacaaattaataattaatatcttaagtgtaacttttaaa |
27219424 |
T |
 |
| Q |
384 |
tgtgtgattgtgtctgtagtccatgtttgttgtgtttccccatagtcgatatactct--ttttggcggtggccggggtttgaaccccggatcttgcatat |
481 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
27219423 |
tgtatgattgtgtctgtagtccatgtttgttgtgttttcccatagtcgatatactctttttttggcggtggccggggtttgaaccctggatcttacatat |
27219324 |
T |
 |
| Q |
482 |
attatg |
487 |
Q |
| |
|
|||||| |
|
|
| T |
27219323 |
attatg |
27219318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 79 - 257
Target Start/End: Original strand, 27216690 - 27216870
Alignment:
| Q |
79 |
attattttgatatatcataacttttgattgcttttagggtaagaatacatatatctaccctccccaaactctaccttacgggagccacgcgcactgggtc |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||| | |||| ||||||||||| |||||||||||||| ||||||| || ||||| | | |
|
|
| T |
27216690 |
attattttgatatatcataacttttgattgcttctagtgtaagactgcatacatctaccctccacaaactctaccttatgggagcctcgtacactgagcc |
27216789 |
T |
 |
| Q |
179 |
accctatataatttctgattgct--tagacacgtatttaagaattgtgcattcttcaatgtgcatggtatttgtatagagt |
257 |
Q |
| |
|
||||| ||||||||||||||||| || |||| ||||||||||||| ||||||||||| ||||||||||| ||||||||| |
|
|
| T |
27216790 |
accctttataatttctgattgcttatacacacctatttaagaattgcccattcttcaatatgcatggtattagtatagagt |
27216870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 22522785 - 22522835
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22522785 |
tttttggtggtggccggggtttgaaccccggaccttgcatatattatgcat |
22522835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 284 - 336
Target Start/End: Complemental strand, 27217022 - 27216970
Alignment:
| Q |
284 |
ttgtggtatgatttggttgaatgtatgcgtcaaacagttttacattgtctgat |
336 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
27217022 |
ttgtggtataatttggttgaatgtatgcgtaaaacagttttacaatgtctgat |
27216970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 6489084 - 6489034
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
6489084 |
tttttggtggtggccggggtttgaaccccagaccttgcatatattatgcat |
6489034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 6624853 - 6624803
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
6624853 |
tttttggtggtggccggggttcgaaccccggaccttgcatatattatgcat |
6624803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 40715941 - 40715983
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40715941 |
ggtggccggggtttgaaccccggaccttgcatatattatgcat |
40715983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 444 - 490
Target Start/End: Complemental strand, 16094130 - 16094084
Alignment:
| Q |
444 |
tggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||| ||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
16094130 |
tggcggtggtcggggtttgaaccccagatcttacatatattatgcat |
16094084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 486
Target Start/End: Original strand, 22665187 - 22665233
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattat |
486 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
22665187 |
tttttggtggtggccggggtttgaactccggatcttgcatattttat |
22665233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 26655541 - 26655491
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
26655541 |
tttttggtggtggccggggttcgaaccccggaccttacatatattatgcat |
26655491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 26927126 - 26927076
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
26927126 |
tttttggtggtggccggggttcgaaccccggaccttacatatattatgcat |
26927076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 32339812 - 32339762
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
32339812 |
tttttggtggtggccgggattcgaaccccggaccttgcatatattatgcat |
32339762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 34191510 - 34191460
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
34191510 |
tttttggtagtggccggggtttgaaccccggaccttgcatattttatgcat |
34191460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 440 - 485
Target Start/End: Complemental strand, 4009944 - 4009899
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatatta |
485 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4009944 |
tttttggtggtggccggggtttgaaccccggcccttgcatatatta |
4009899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 441 - 490
Target Start/End: Complemental strand, 34436927 - 34436878
Alignment:
| Q |
441 |
ttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34436927 |
ttttggtggtgggcggggtttgaaccccggcccttgcatatattatgcat |
34436878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 42473962 - 42473921
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
42473962 |
gtggccgtggtttgaaccccggaccttgcatatattatgcat |
42473921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 442 - 490
Target Start/End: Original strand, 3445233 - 3445281
Alignment:
| Q |
442 |
tttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
3445233 |
tttggtggtggccgggatttgaaccccggaccttgcatacattatgcat |
3445281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 448 - 488
Target Start/End: Complemental strand, 14474903 - 14474863
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgc |
488 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
14474903 |
ggtggccggggtttgaaccctggaccttgcatatattatgc |
14474863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 438 - 490
Target Start/End: Complemental strand, 37932409 - 37932357
Alignment:
| Q |
438 |
tctttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| | ||||||| ||||| |||||||||| |||||||||||||||||| |
|
|
| T |
37932409 |
tcttttttgtggtggccagggttcgaaccccggaccttgcatatattatgcat |
37932357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 443 - 490
Target Start/End: Complemental strand, 11720967 - 11720921
Alignment:
| Q |
443 |
ttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
11720967 |
ttggtggtggccggggtttgaacccc-gaccttgcatatattatgcat |
11720921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 448 - 487
Target Start/End: Complemental strand, 13864413 - 13864374
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
13864413 |
ggtggtcggggtttgaaccccggaccttgcatatattatg |
13864374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Complemental strand, 31877990 - 31877955
Alignment:
| Q |
455 |
ggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31877990 |
ggggtttgaacccctgatcttgcatatattatgcat |
31877955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 15889488 - 15889438
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
15889488 |
tttttggtggtggtcggggtttgaaccctagaccttgcatatattatgcat |
15889438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 17090935 - 17090893
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
17090935 |
ggtggccggggtttgaaccccggaccttgcattaattatgcat |
17090893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 18147787 - 18147745
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
18147787 |
ggtgaccgggggttgaaccccggatcctgcatatattatgcat |
18147745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 18331776 - 18331734
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||| |||||||| |
|
|
| T |
18331776 |
ggtggccggggcttgaaccccggaccttgcatattttatgcat |
18331734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 20688117 - 20688067
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||| | |||||||| ||||| |||||||||||||||||| |
|
|
| T |
20688117 |
tttttggtggtggccagagtttgaactccggaccttgcatatattatgcat |
20688067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 24408572 - 24408522
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
24408572 |
tttttggtagtggtcggggtttgaaccccagaccttgcatatattatgcat |
24408522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 25979913 - 25979871
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
25979913 |
ggtggccgaggtttgaaccccggaccttgcatacattatgcat |
25979871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 31280088 - 31280046
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| || |||||||||||||||| ||||||||||||||||| |
|
|
| T |
31280088 |
ggtggtcgaggtttgaaccccggatattgcatatattatgcat |
31280046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 32200439 - 32200481
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
32200439 |
ggtggtcggggcttgaaccccggaccttgcatatattatgcat |
32200481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 37021364 - 37021406
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
37021364 |
ggtggtcggggtttgaaccctgaatcttgcatatattatgcat |
37021406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 37462180 - 37462138
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
37462180 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
37462138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 39980585 - 39980535
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||| |||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
39980585 |
tttttggtggtggtcggggtttgaactccggaccttgcatattttatgcat |
39980535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 487
Target Start/End: Complemental strand, 20721113 - 20721080
Alignment:
| Q |
454 |
cggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
20721113 |
cggggtttgaaccccggaccttgcatatattatg |
20721080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 33412159 - 33412118
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||||||||| |
|
|
| T |
33412159 |
gtggccggggtttgaatcctggaccttgcatatattatgcat |
33412118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 458 - 490
Target Start/End: Complemental strand, 3389221 - 3389189
Alignment:
| Q |
458 |
gtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
3389221 |
gtttgaaccccagatcttgcatatattatgcat |
3389189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 490
Target Start/End: Original strand, 21139146 - 21139182
Alignment:
| Q |
454 |
cggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
21139146 |
cgggttttgaaccccggaccttgcatatattatgcat |
21139182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 440 - 484
Target Start/End: Original strand, 31958452 - 31958496
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatatt |
484 |
Q |
| |
|
||||||| |||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
31958452 |
tttttggtggtgtccggggttcgaaccccggaccttgcatatatt |
31958496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 485
Target Start/End: Original strand, 38976702 - 38976730
Alignment:
| Q |
457 |
ggtttgaaccccggatcttgcatatatta |
485 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38976702 |
ggtttgaaccccggatcttgcatatatta |
38976730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 34)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 12748978 - 12748928
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12748978 |
tttttggtggtggccggggtttgaaccccggaccttgcatatattatgcat |
12748928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 440 - 489
Target Start/End: Original strand, 32286348 - 32286397
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgca |
489 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32286348 |
tttttggtggtggccggggtttgaaccccgaatcttgcatatattatgca |
32286397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 442 - 490
Target Start/End: Original strand, 32051518 - 32051566
Alignment:
| Q |
442 |
tttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32051518 |
tttggtggtggccggggtttgaaccccggaccttgcatatattatgcat |
32051566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 13286207 - 13286158
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13286207 |
ttttttgcggtggccggggtttgaaccc-ggatcttgcatatattatgcat |
13286158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 486
Target Start/End: Complemental strand, 15020838 - 15020792
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattat |
486 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15020838 |
tttttggtggtggccagggtttgaaccccggatcttgcatatattat |
15020792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 19260563 - 19260613
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
19260563 |
tttttggtggtggccggggtttgaaccccggaccttacatatattatgcat |
19260613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 24838154 - 24838204
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
24838154 |
tttttggtggtggccggggtttgaaccccggaccttgcatattttatgcat |
24838204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 27587298 - 27587248
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
27587298 |
tttttggtggtggccggggtttgaaccccggaccttgcatatatcatgcat |
27587248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 30176403 - 30176453
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30176403 |
tttttggtggtgtccggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 455 - 490
Target Start/End: Complemental strand, 18533731 - 18533696
Alignment:
| Q |
455 |
ggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
18533731 |
ggggtttgaaccccggatcttgcatatattatgcat |
18533696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 444482 - 444440
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
444482 |
ggtggccggggtttaaaccccggaccttgcatatattatgcat |
444440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8881344 - 8881302
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
8881344 |
ggtggccggggtttgaaccctggaccttgcatatattatgcat |
8881302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 10601840 - 10601790
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
10601840 |
tttttggttgtggccggggtttgaatcccgaatcttgcatatattatgcat |
10601790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 441 - 487
Target Start/End: Original strand, 12800885 - 12800931
Alignment:
| Q |
441 |
ttttggcggtggccggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
|||||| ||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
12800885 |
ttttggtggtggtcggggtttgaaccccggaccttgcatatattatg |
12800931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 22775705 - 22775655
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||| |||||||||||||||| |||||||| ||||||||| |
|
|
| T |
22775705 |
tttttggtggtggccagggtttgaaccccggaccttgcataaattatgcat |
22775655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 23159510 - 23159468
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23159510 |
ggtggtcggggtttgaaccccgaatcttgcatatattatgcat |
23159468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 33105468 - 33105418
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| || ||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33105468 |
tttttggtggaggctggggtttgaaccccggaccttgcatatattatgcat |
33105418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 44794970 - 44794920
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||| ||||||||| ||||| |||||||||||||||||| |
|
|
| T |
44794970 |
ttttttgcggtggccgaggtttgaactccggaccttgcatatattatgcat |
44794920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 450 - 490
Target Start/End: Original strand, 13124357 - 13124397
Alignment:
| Q |
450 |
tggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
13124357 |
tggccggggtttgaaccccggaccttgcatattttatgcat |
13124397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 443 - 490
Target Start/End: Complemental strand, 6471585 - 6471538
Alignment:
| Q |
443 |
ttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
6471585 |
ttggtggtggccggggtttgaaccccgaacattgcatatattatgcat |
6471538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Original strand, 42172242 - 42172277
Alignment:
| Q |
455 |
ggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42172242 |
ggggtttgaactccggatcttgcatatattatgcat |
42172277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 3650589 - 3650547
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||| | ||| |||||||||||||| |
|
|
| T |
3650589 |
ggtggccggggtttgaaccccgaaccttacatatattatgcat |
3650547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 6235543 - 6235585
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||| |||||| ||| |||||||||||||| |
|
|
| T |
6235543 |
ggtggccggggtttgaatcccggaccttacatatattatgcat |
6235585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 8717467 - 8717509
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
8717467 |
ggtggccgaggtttgaaccccgaaccttgcatatattatgcat |
8717509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 13357425 - 13357475
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||| |||||||||| || | |||||||||||||||||| |
|
|
| T |
13357425 |
tttttggtggtggccgaggtttgaacctcgtaccttgcatatattatgcat |
13357475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 15001259 - 15001309
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
15001259 |
tttttggtggtggccggggtttgaaccttggaccttgcatattttatgcat |
15001309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 19163528 - 19163570
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
19163528 |
ggtggtcggggtttgaaccccggaccttgcataaattatgcat |
19163570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 20665355 - 20665397
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
20665355 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
20665397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 30550718 - 30550760
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
30550718 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
30550760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 37141426 - 37141384
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
37141426 |
ggtggccggagtttgaaccccgaaccttgcatatattatgcat |
37141384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 44215467 - 44215509
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
44215467 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
44215509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 24023408 - 24023449
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
24023408 |
gtggtcggggtttgaaccccggaccttgcatattttatgcat |
24023449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 448 - 488
Target Start/End: Complemental strand, 7997009 - 7996969
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgc |
488 |
Q |
| |
|
||||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
7997009 |
ggtggtcggggtttgaaccccagaccttgcatatattatgc |
7996969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Original strand, 10871888 - 10871928
Alignment:
| Q |
450 |
tggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
10871888 |
tggccgaggtttgaaccccggaccttgcatacattatgcat |
10871928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 48)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 38130943 - 38130993
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38130943 |
tttttggtggtggccggggtttgaaccccggaccttgcatatattatgcat |
38130993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 438 - 490
Target Start/End: Original strand, 48849745 - 48849797
Alignment:
| Q |
438 |
tctttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| | |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48849745 |
tcttttttgtggtggccggggtttgaaccccggaccttgcatatattatgcat |
48849797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 448 - 487
Target Start/End: Complemental strand, 11358303 - 11358264
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11358303 |
ggtggccggggtttgaaccccggatcttgcatatattatg |
11358264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 4601921 - 4601871
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
4601921 |
tttttggtggtggccggggtttgaaccccggaccttgcatttattatgcat |
4601871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 25340908 - 25340958
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
25340908 |
tttttggtggtggccggggtttgaaccccggaccttgcatattttatgcat |
25340958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 51882192 - 51882234
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51882192 |
ggtggccggggtttgaaccctggatcttgcatatattatgcat |
51882234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 454 - 490
Target Start/End: Original strand, 10922306 - 10922342
Alignment:
| Q |
454 |
cggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10922306 |
cggggtttgaaccccggatcttgcatatattatgcat |
10922342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 334839 - 334881
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
334839 |
ggtggccggggtttgaaccccggaccttgcatattttatgcat |
334881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 913584 - 913634
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||| | ||||||||||||||| |||||||||||||||||| |
|
|
| T |
913584 |
tttttggtggtggcagaggtttgaaccccggaccttgcatatattatgcat |
913634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 14827594 - 14827552
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
14827594 |
ggtggccggggtttaaaccccggatcttgcatattttatgcat |
14827552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 16792958 - 16793008
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
16792958 |
tttttggtggtgaccggggtttgaaccctggaccttgcatatattatgcat |
16793008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 25441492 - 25441534
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
25441492 |
ggtggccggggtttgaaccccagaccttgcatatattatgcat |
25441534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 29631263 - 29631213
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
29631263 |
tttttggtggtggccggggtttgaatcccgaaccttgcatatattatgcat |
29631213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 34899166 - 34899124
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34899166 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcat |
34899124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 41817576 - 41817526
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
41817576 |
tttttggtggtggctagggtttgaaccccggaccttgcatatattatgcat |
41817526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 45432017 - 45431975
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
45432017 |
ggtggccagggtttgaaccccggaccttgcatatattatgcat |
45431975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 441 - 490
Target Start/End: Original strand, 22251445 - 22251494
Alignment:
| Q |
441 |
ttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| ||||||||||||| |||||||||| | |||||||||||||||| |
|
|
| T |
22251445 |
ttttggtggtggccggggttcgaaccccggaccgtgcatatattatgcat |
22251494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 438 - 490
Target Start/End: Original strand, 55066582 - 55066634
Alignment:
| Q |
438 |
tctttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||| |||||||||| |||||||||| || | |||||||||||||||| |
|
|
| T |
55066582 |
tctttttggtggtggccgggatttgaaccccagaccatgcatatattatgcat |
55066634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 916508 - 916466
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
916508 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
916466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 7464483 - 7464525
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
7464483 |
ggtggtcggggtttgaaccccggaccttacatatattatgcat |
7464525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8075854 - 8075812
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||| | || |||||||||||||||||| |
|
|
| T |
8075854 |
ggtggccggggtttgaacctcagaccttgcatatattatgcat |
8075812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 8113554 - 8113596
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
8113554 |
ggtggccgggattcgaaccgcggatcttgcatatattatgcat |
8113596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8238633 - 8238591
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
8238633 |
ggtggccggagtttgaaccccagaccttgcatatattatgcat |
8238591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 10102868 - 10102826
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| |||||||||| |
|
|
| T |
10102868 |
ggtggccggggtttgaaccctggattttgcatgtattatgcat |
10102826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 10213791 - 10213749
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| |||||||||| |
|
|
| T |
10213791 |
ggtggccggggtttgaaccctggattttgcatgtattatgcat |
10213749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 456 - 490
Target Start/End: Original strand, 16663236 - 16663270
Alignment:
| Q |
456 |
gggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
16663236 |
gggtttgaaccccggaccttgcatatattatgcat |
16663270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 17262253 - 17262204
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||| |||||||||| | ||||||||| |||||||| |
|
|
| T |
17262253 |
tttttggcggtggccgggg-ttgaaccccgaaccttgcatattttatgcat |
17262204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 20612261 - 20612311
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
20612261 |
tttttggtagtggccggggtttgaaccccaaaccttgcatatattatgcat |
20612311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 25727959 - 25728001
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
25727959 |
ggtggtcgggatttgaaccccggaccttgcatatattatgcat |
25728001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 30050420 - 30050462
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||| ||||||||| || |||||||||||||||||||| |
|
|
| T |
30050420 |
ggtggccggagtttgaaccgcgaatcttgcatatattatgcat |
30050462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 32843254 - 32843296
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| |||||||| |
|
|
| T |
32843254 |
ggtggccggggtttgaaccccagaccttgcatattttatgcat |
32843296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 35191801 - 35191851
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||| | |||||| ||||||| || |||||||||||||||||| |
|
|
| T |
35191801 |
tttttggcggtgtctggggttcgaaccccagaccttgcatatattatgcat |
35191851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 38603035 - 38602985
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||||||||| | | |||||||||||||||||| |
|
|
| T |
38603035 |
tttttggtggtggccggggtttgaaccatgaaccttgcatatattatgcat |
38602985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 44075148 - 44075190
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
44075148 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
44075190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 45334266 - 45334216
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||| |||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
45334266 |
tttttggtggtggtcgggatttgaaccccgaaccttgcatatattatgcat |
45334216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 48796210 - 48796252
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| |||||||| |
|
|
| T |
48796210 |
ggtggccggggtttgaaccccgaaccttgcatatcttatgcat |
48796252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 52119445 - 52119403
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||| |||||||| | |||||||||||||||||| |
|
|
| T |
52119445 |
ggtggccggggttcgaaccccgaaccttgcatatattatgcat |
52119403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 54243454 - 54243412
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
54243454 |
ggtggccgaggtttgaaccccggatcttaaatatattatgcat |
54243412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 440 - 489
Target Start/End: Complemental strand, 552251 - 552202
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgca |
489 |
Q |
| |
|
||||||| || || |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
552251 |
tttttggtggaggtcggggtttgaaccctggaccttgcatatattatgca |
552202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 34442440 - 34442481
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
34442440 |
gtggccggggtttgaaccccggaccttacatattttatgcat |
34442481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 453 - 490
Target Start/End: Original strand, 35126266 - 35126303
Alignment:
| Q |
453 |
ccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
35126266 |
ccgggatttgaaccccagatcttgcatatattatgcat |
35126303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 443 - 488
Target Start/End: Original strand, 35210118 - 35210163
Alignment:
| Q |
443 |
ttggcggtggccggggtttgaaccccggatcttgcatatattatgc |
488 |
Q |
| |
|
|||| |||||||| ||||||||||||||| ||||||||| |||||| |
|
|
| T |
35210118 |
ttggtggtggccgaggtttgaaccccggaccttgcatattttatgc |
35210163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 438 - 487
Target Start/End: Original strand, 35863795 - 35863844
Alignment:
| Q |
438 |
tctttttggcggtggccggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
||||||| | |||||||| |||||||||||| || ||||||||||||||| |
|
|
| T |
35863795 |
tcttttttgtggtggccgaggtttgaaccccagaccttgcatatattatg |
35863844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 448 - 489
Target Start/End: Original strand, 45885469 - 45885510
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgca |
489 |
Q |
| |
|
||||||||||||||||||| | || ||||||||||||||||| |
|
|
| T |
45885469 |
ggtggccggggtttgaacctcagaccttgcatatattatgca |
45885510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 48315017 - 48315058
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
48315017 |
gtggtcgggatttgaaccccggaccttgcatatattatgcat |
48315058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 457 - 490
Target Start/End: Original strand, 48656900 - 48656933
Alignment:
| Q |
457 |
ggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
48656900 |
ggtttgaaccccggaccttgcatatattatgcat |
48656933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 440 - 481
Target Start/End: Complemental strand, 53365981 - 53365940
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatat |
481 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| ||||||||| |
|
|
| T |
53365981 |
tttttggtggtggccgggatttgaaccccggaccttgcatat |
53365940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 458 - 490
Target Start/End: Original strand, 24120422 - 24120454
Alignment:
| Q |
458 |
gtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
24120422 |
gtttgaaccgcggatcttgcatatattatgcat |
24120454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 56)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 10735815 - 10735865
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10735815 |
tttttggtggtggccggggtttgaaccccggaccttgcatatattatgcat |
10735865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 29544704 - 29544654
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29544704 |
tttttggtggtggccggggtttgaaccccggaccttgcatatattatgcat |
29544654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 443 - 490
Target Start/End: Complemental strand, 27848232 - 27848185
Alignment:
| Q |
443 |
ttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27848232 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcat |
27848185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 24592830 - 24592880
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
24592830 |
tttttggtggtggccggggtttgaaccccagaccttgcatatattatgcat |
24592880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 42791372 - 42791322
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42791372 |
tttttggtagtggccggggtttgaaccccggaccttgcatatattatgcat |
42791322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 440 - 489
Target Start/End: Complemental strand, 27411169 - 27411120
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgca |
489 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
27411169 |
tttttggtggtggccggggttcgaaccccggaccttgcatatattatgca |
27411120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 440 - 487
Target Start/End: Complemental strand, 44810782 - 44810735
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
||||||| |||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
44810782 |
tttttggtggtggctggggtttgaaccccggaccttgcatatattatg |
44810735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 11175854 - 11175812
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
11175854 |
ggtggccggagtttgaaccccagatcttgcatatattatgcat |
11175812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 16390680 - 16390630
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
16390680 |
tttttggtggtggccggggttcgaaccccggaccttgcatattttatgcat |
16390630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 20200774 - 20200732
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
20200774 |
ggtggccggggtttgaaccctggaccttgcatatattatgcat |
20200732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 25186234 - 25186276
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25186234 |
ggtggctggggtttgaaccccggaccttgcatatattatgcat |
25186276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 28771659 - 28771609
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||| |||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
28771659 |
tttttggtggtgtccggggttcgaaccgcggatcttgcatatattatgcat |
28771609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 31815879 - 31815921
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31815879 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcat |
31815921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 18693655 - 18693696
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18693655 |
gtggtcggggtttgaaccctggatcttgcatatattatgcat |
18693696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 22709153 - 22709112
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
22709153 |
gtggccggggtttgaaccccggaccttgcatattttatgcat |
22709112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Original strand, 20565074 - 20565109
Alignment:
| Q |
455 |
ggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20565074 |
ggggtttgaaccccggaccttgcatatattatgcat |
20565109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Complemental strand, 31543074 - 31543039
Alignment:
| Q |
455 |
ggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31543074 |
ggggtttgaaccccggaccttgcatatattatgcat |
31543039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 660814 - 660856
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
660814 |
ggtggtcggggtttgaaccctggaccttgcatatattatgcat |
660856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 2257040 - 2256998
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
2257040 |
ggtggccggggttcgaaccccagaccttgcatatattatgcat |
2256998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 3708762 - 3708720
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
3708762 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
3708720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 4180774 - 4180724
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||| |||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
4180774 |
tttttggtagtggtcggggtttgaaccccggaccttgcatattttatgcat |
4180724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 450 - 488
Target Start/End: Original strand, 4927443 - 4927481
Alignment:
| Q |
450 |
tggccggggtttgaaccccggatcttgcatatattatgc |
488 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
4927443 |
tggccggggtttgaaccccggaccttacatatattatgc |
4927481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 5168563 - 5168613
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||| | |||||||||||||||| | |||||||||||||||||| |
|
|
| T |
5168563 |
tttttggtggtagtcggggtttgaaccccgaaccttgcatatattatgcat |
5168613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8728888 - 8728846
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
8728888 |
ggtggtcggggtttgaaccctggatcttgcatattttatgcat |
8728846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 9516993 - 9517043
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||| |||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
9516993 |
tttttggtggtggccgaggttcgaaacccggatcttgtatatattatgcat |
9517043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 10724008 - 10723966
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||| | || |||||||||||||||||| |
|
|
| T |
10724008 |
ggtggccggggtttgaacctcagaccttgcatatattatgcat |
10723966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 11868654 - 11868696
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
11868654 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
11868696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 11931674 - 11931632
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||| |||| | ||||||||||||||||||||||||| |
|
|
| T |
11931674 |
ggtggccgggttttgtatcccggatcttgcatatattatgcat |
11931632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 15447706 - 15447748
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| || || |||||||||||||||||| |
|
|
| T |
15447706 |
ggtggccggggtttgaactccagaccttgcatatattatgcat |
15447748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 20455960 - 20455918
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
20455960 |
ggtggccgggattcgaaccccggaccttgcatatattatgcat |
20455918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 23250312 - 23250354
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
23250312 |
ggtggtcggggtttgaaccctggaccttgcatatattatgcat |
23250354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 30089118 - 30089076
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
30089118 |
ggtggccgaggtttgaaccccggaccttgtatatattatgcat |
30089076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 30125722 - 30125680
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
30125722 |
ggtggccgaggtttgaaccccggaccttgtatatattatgcat |
30125680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 30243327 - 30243277
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||| ||||||||||||| | |||| ||||||||||||| |
|
|
| T |
30243327 |
tttttggtggtggccgaggtttgaaccccgaaccttgtatatattatgcat |
30243277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 33064063 - 33064013
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||| ||| |||| ||||| |||||||||||||||||| |
|
|
| T |
33064063 |
tttttggtggtggccggagttcgaactccggaccttgcatatattatgcat |
33064013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 34977273 - 34977231
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
34977273 |
ggtggccggggtttaaactccggaccttgcatatattatgcat |
34977231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 35360047 - 35360089
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
35360047 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
35360089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 35820293 - 35820335
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||| |||||||||| |
|
|
| T |
35820293 |
ggtggccgaggtttgaaccccggaccttgcatgtattatgcat |
35820335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 36359383 - 36359341
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
36359383 |
ggtggccaaggtttgaaccccggaccttgcatatattatgcat |
36359341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 36474839 - 36474789
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
36474839 |
tttttggtggtggccggaatttgaaccccggaccttgcatattttatgcat |
36474789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 41778928 - 41778978
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||| || ||||| |||| |||||||||||||||||| |
|
|
| T |
41778928 |
tttttggtggtggccgggattcgaacctcggaccttgcatatattatgcat |
41778978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 41859921 - 41859879
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| |||||||| |
|
|
| T |
41859921 |
ggtggccggggtttgaaccccagaccttgcatattttatgcat |
41859879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 44526197 - 44526155
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||| |||||| ||||| |||||||||||| |
|
|
| T |
44526197 |
ggtggccggggtttgaatcccggaccttgcgtatattatgcat |
44526155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 8781643 - 8781684
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
8781643 |
gtggtcggggtttgaaccccggaccttgcatacattatgcat |
8781684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 11551236 - 11551195
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
11551236 |
gtggccggagtttgaaccccgaatcttgcatattttatgcat |
11551195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 40853811 - 40853852
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
40853811 |
gtggtcggggtttgatccccggaccttgcatatattatgcat |
40853852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Complemental strand, 7206192 - 7206152
Alignment:
| Q |
450 |
tggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||||||||||| |
|
|
| T |
7206192 |
tggccggggtttaaacctcggaccttgcatatattatgcat |
7206152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 458 - 490
Target Start/End: Original strand, 8091160 - 8091192
Alignment:
| Q |
458 |
gtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
8091160 |
gtttgaaccccggaccttgcatatattatgcat |
8091192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 440 - 488
Target Start/End: Complemental strand, 10811145 - 10811097
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgc |
488 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| ||||||||| |||||| |
|
|
| T |
10811145 |
tttttggtagtggctggggtttgaaccccggaccttgcatattttatgc |
10811097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 29734754 - 29734718
Alignment:
| Q |
454 |
cggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
29734754 |
cggggtttgaaccacggaccttgcatatattatgcat |
29734718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 442 - 490
Target Start/End: Original strand, 29896280 - 29896328
Alignment:
| Q |
442 |
tttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| ||||| ||||||||||||||| | |||||||||||||||||| |
|
|
| T |
29896280 |
tttggtggtggtcggggtttgaaccccaaaccttgcatatattatgcat |
29896328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 442 - 490
Target Start/End: Complemental strand, 31477046 - 31476998
Alignment:
| Q |
442 |
tttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||| ||||||||||| | |||| ||||||||||||| |
|
|
| T |
31477046 |
tttggtggtggccgggatttgaaccccgaaccttgtatatattatgcat |
31476998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 446 - 490
Target Start/End: Complemental strand, 33567732 - 33567688
Alignment:
| Q |
446 |
gcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||| | |||||| |
|
|
| T |
33567732 |
gcggtggccggggtttgaaccctggaacttgcatatttcatgcat |
33567688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Original strand, 41763872 - 41763912
Alignment:
| Q |
450 |
tggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| ||||||| |
|
|
| T |
41763872 |
tggccggggtttgaaccccggaccgtgcatatactatgcat |
41763912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 440 - 488
Target Start/End: Complemental strand, 42754122 - 42754074
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgc |
488 |
Q |
| |
|
||||||| ||||||||||| | ||||| |||| |||||||||||||||| |
|
|
| T |
42754122 |
tttttggtggtggccggggatcgaacctcggaccttgcatatattatgc |
42754074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Complemental strand, 44694755 - 44694715
Alignment:
| Q |
450 |
tggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44694755 |
tggccggggtttgaaccccgagccttgcatatattatgcat |
44694715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 39)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 14046603 - 14046645
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14046603 |
ggtggccggggtttgaaccccgtatcttgcatatattatgcat |
14046645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 14356633 - 14356675
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14356633 |
ggtggccggggtttgaaccccgtatcttgcatatattatgcat |
14356675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 19416591 - 19416541
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
19416591 |
tttttggtggtggccggggtttgaaccccggaccttgcatattttatgcat |
19416541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 27462428 - 27462470
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27462428 |
ggtggccggggtttgaaccccggaccttgcatatattatgcat |
27462470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 8084504 - 8084454
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
8084504 |
tttttggtggtggccggggttcgaaccccggaccttgcatattttatgcat |
8084454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 18714525 - 18714475
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18714525 |
tttttggtggtgtacggggtttgaaccccggaccttgcatatattatgcat |
18714475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 19599214 - 19599172
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19599214 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcat |
19599172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 21322252 - 21322202
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| |||||||| ||||||||| |
|
|
| T |
21322252 |
tttttggtggtggccggggtttgaaccctggaccttgcatacattatgcat |
21322202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 36121729 - 36121679
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
36121729 |
tttttggtagtggccggggtttgaaccccggaccttgcatattttatgcat |
36121679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 42829226 - 42829268
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
42829226 |
ggtggccggagtttgaaccccggagcttgcatatattatgcat |
42829268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 440 - 485
Target Start/End: Complemental strand, 145595 - 145550
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatatta |
485 |
Q |
| |
|
||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
145595 |
tttttggtggtggtcggggtttgaaccccggaccttgcatatatta |
145550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 19626518 - 19626559
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
19626518 |
gtggccggtgtttgaaccccggaccttgcatatattatgcat |
19626559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 46737853 - 46737812
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
46737853 |
gtggccggtgtttgaaccccggaccttgcatatattatgcat |
46737812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 441 - 488
Target Start/End: Complemental strand, 2512385 - 2512338
Alignment:
| Q |
441 |
ttttggcggtggccggggtttgaaccccggatcttgcatatattatgc |
488 |
Q |
| |
|
|||||| ||||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
2512385 |
ttttggtggtggccggggtttgaacctcgtaccttgcatatattatgc |
2512338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Original strand, 20085758 - 20085793
Alignment:
| Q |
455 |
ggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20085758 |
ggggtttgaaccccggaccttgcatatattatgcat |
20085793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 3830137 - 3830095
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
3830137 |
ggtggctggggtttgaaccctggaccttgcatatattatgcat |
3830095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 456 - 490
Target Start/End: Complemental strand, 10244788 - 10244754
Alignment:
| Q |
456 |
gggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
10244788 |
gggtttgaaccccggaccttgcatatattatgcat |
10244754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 20763223 - 20763181
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
20763223 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
20763181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 482
Target Start/End: Complemental strand, 21174436 - 21174394
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatata |
482 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||| |||||| |
|
|
| T |
21174436 |
tttttggtggtggccggggtttgaaccccggaactttcatata |
21174394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 27833393 - 27833435
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
27833393 |
ggtggtcggggtttgaaccccggaccttacatatattatgcat |
27833435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 29488789 - 29488747
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
29488789 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
29488747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 31038506 - 31038556
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||||||||||| || |||||||| | ||||||| |
|
|
| T |
31038506 |
tttttggtggtggccggggtttgaaccccagaccttgcatacaatatgcat |
31038556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 33232389 - 33232431
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
33232389 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
33232431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 33473505 - 33473555
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||| ||||| |||||| ||| |||||||||||||||||| |
|
|
| T |
33473505 |
tttttggtggtggccagggttggaaccctggaccttgcatatattatgcat |
33473555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 34284531 - 34284573
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
34284531 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
34284573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 39801783 - 39801733
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||| |||||| | ||||||||||||||||||||||||||| |
|
|
| T |
39801783 |
tttttggtggtggttggggttcgtaccccggatcttgcatatattatgcat |
39801733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 42095935 - 42095977
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| | ||||||||||||||| |||||||||||||||||| |
|
|
| T |
42095935 |
ggtggcagaggtttgaaccccggaccttgcatatattatgcat |
42095977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 43346548 - 43346598
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||| ||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
43346548 |
tttttggtggtggatggggtttgatccccggatcttacatatattatgcat |
43346598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 46987155 - 46987113
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
46987155 |
ggtgtccggggttcgaaccccggaccttgcatatattatgcat |
46987113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 48629057 - 48629099
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
48629057 |
ggtggtcggggtttaaaccccggaccttgcatatattatgcat |
48629099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 448 - 489
Target Start/End: Complemental strand, 5579762 - 5579721
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgca |
489 |
Q |
| |
|
||||| ||||||||||||||| || ||||||||||||||||| |
|
|
| T |
5579762 |
ggtggtcggggtttgaaccccagaccttgcatatattatgca |
5579721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 457 - 490
Target Start/End: Complemental strand, 7670494 - 7670461
Alignment:
| Q |
457 |
ggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
7670494 |
ggtttgaaccccggaccttgcatatattatgcat |
7670461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 10421990 - 10422031
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| ||||||||||| |||||| |||||||||||||| |
|
|
| T |
10421990 |
gtggccggagtttgaaccccagatcttacatatattatgcat |
10422031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 453 - 486
Target Start/End: Complemental strand, 23147354 - 23147321
Alignment:
| Q |
453 |
ccggggtttgaaccccggatcttgcatatattat |
486 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
23147354 |
ccggggtttgaaccccggaccttgcatatattat |
23147321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 448 - 489
Target Start/End: Original strand, 42753519 - 42753560
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgca |
489 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
42753519 |
ggtggctggagtttgaaccccggaccttgcatatattatgca |
42753560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 441 - 490
Target Start/End: Complemental strand, 46371057 - 46371008
Alignment:
| Q |
441 |
ttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| ||||| ||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
46371057 |
ttttggtggtggtcggagtttgaaccccggaccttggatatattatgcat |
46371008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 462 - 490
Target Start/End: Original strand, 1285075 - 1285103
Alignment:
| Q |
462 |
gaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1285075 |
gaaccccggatcttgcatatattatgcat |
1285103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 10242543 - 10242507
Alignment:
| Q |
454 |
cggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
10242543 |
cggggtttgaaccctggaccttgcatatattatgcat |
10242507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 458 - 490
Target Start/End: Original strand, 39280820 - 39280852
Alignment:
| Q |
458 |
gtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
39280820 |
gtttgaaccccggaccttgcatatattatgcat |
39280852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 34)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8569778 - 8569736
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8569778 |
ggtggccggggtttgaaccccggaccttgcatatattatgcat |
8569736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 655733 - 655783
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
655733 |
tttttggtagtggccggggttcgaaccccggaccttgcatatattatgcat |
655783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 7082976 - 7083026
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
7082976 |
tttttggtggtggctggggtttgaactccagatcttgcatatattatgcat |
7083026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 27907935 - 27907985
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||||||||||| || ||||||||| |||||||| |
|
|
| T |
27907935 |
tttttggtggtggccggggtttgaaccccagaccttgcatattttatgcat |
27907985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 29740551 - 29740509
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
29740551 |
ggtggccggggtttgaaccccggaccttgcgtatattatgcat |
29740509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 33824950 - 33824908
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
33824950 |
ggtggccgaggtttgaaccccggaccttgcatatattatgcat |
33824908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 2655020 - 2655061
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
2655020 |
gtggccggggtttgaaccccggatcttacatattttatgcat |
2655061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 8809369 - 8809333
Alignment:
| Q |
454 |
cggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8809369 |
cggggtttgaacctcggatcttgcatatattatgcat |
8809333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 450 - 490
Target Start/End: Complemental strand, 33976311 - 33976271
Alignment:
| Q |
450 |
tggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
33976311 |
tggccggggtttgaaccccggaccttgcatattttatgcat |
33976271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Complemental strand, 291429 - 291394
Alignment:
| Q |
455 |
ggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
291429 |
ggggtttgaaccccggaccttgcatatattatgcat |
291394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 440 - 487
Target Start/End: Complemental strand, 17151313 - 17151266
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
||||||| |||||||| |||||||||||| || ||||||||||||||| |
|
|
| T |
17151313 |
tttttggtggtggccgaggtttgaaccccagaccttgcatatattatg |
17151266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 447 - 490
Target Start/End: Complemental strand, 28898926 - 28898883
Alignment:
| Q |
447 |
cggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
28898926 |
cggtggccggggtttgaactccggacctttcatatattatgcat |
28898883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 247728 - 247686
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
247728 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
247686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 441 - 487
Target Start/End: Complemental strand, 2546256 - 2546210
Alignment:
| Q |
441 |
ttttggcggtggccggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
|||||| ||||| |||||||||||||||| | ||||||||||||||| |
|
|
| T |
2546256 |
ttttggtggtggtcggggtttgaaccccgtaccttgcatatattatg |
2546210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 2726409 - 2726451
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
2726409 |
ggtgaccggggttcgaaccccggaccttgcatatattatgcat |
2726451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 12184577 - 12184535
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
12184577 |
ggtggccgggatttgaaccacggaccttgcatatattatgcat |
12184535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 13496193 - 13496143
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| | ||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
13496193 |
tttttggtgttggtcggggtttgaactccggaccttgcatatattatgcat |
13496143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 15187132 - 15187090
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| ||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
15187132 |
ggtggtcggggtttgaacctcggaccttgcatatattatgcat |
15187090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 15473474 - 15473516
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| ||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
15473474 |
ggtggtcggggtttgaacctcggaccttgcatatattatgcat |
15473516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 16390498 - 16390456
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
16390498 |
ggtggccgaggtttgaaccccggaccttacatatattatgcat |
16390456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 24373702 - 24373744
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
24373702 |
ggtggctggggtttgaacccctgaccttgcatatattatgcat |
24373744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 28231417 - 28231459
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
28231417 |
ggtggccggagtgtgaaccccggaccttgcatatattatgcat |
28231459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 34481398 - 34481448
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||| |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
34481398 |
tttttggttgtggtcggggtttgaaccccggaccttgcatatataatgcat |
34481448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 2692283 - 2692242
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
2692283 |
gtggccagggtttgaatctcggatcttgcatatattatgcat |
2692242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 441 - 490
Target Start/End: Complemental strand, 10018475 - 10018426
Alignment:
| Q |
441 |
ttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| ||||||||| |||||||||||| | ||| |||||||||||||| |
|
|
| T |
10018475 |
ttttggtggtggccggagtttgaaccccgaaccttacatatattatgcat |
10018426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 20744206 - 20744165
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
20744206 |
gtggtcggggtttgaaccccagaccttgcatatattatgcat |
20744165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 26356074 - 26356115
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
26356074 |
gtggccggagtttgaaccccgaaccttgcatatattatgcat |
26356115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 441 - 486
Target Start/End: Complemental strand, 26548327 - 26548282
Alignment:
| Q |
441 |
ttttggcggtggccggggtttgaaccccggatcttgcatatattat |
486 |
Q |
| |
|
|||||| |||||| ||||||||||||||| | |||||||||||||| |
|
|
| T |
26548327 |
ttttggtggtggctggggtttgaaccccgaaccttgcatatattat |
26548282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 442 - 490
Target Start/End: Complemental strand, 2445374 - 2445326
Alignment:
| Q |
442 |
tttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| ||||| ||||||| |||||||| |||||| ||||||||||||| |
|
|
| T |
2445374 |
tttggtggtggtcggggttcgaaccccgaatcttgtatatattatgcat |
2445326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 448 - 488
Target Start/End: Original strand, 4455588 - 4455628
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgc |
488 |
Q |
| |
|
||||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
4455588 |
ggtggtcggggtttgaaccccagaccttgcatatattatgc |
4455628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 9111110 - 9111074
Alignment:
| Q |
454 |
cggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
9111110 |
cggggttcgaaccccggaccttgcatatattatgcat |
9111074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 440 - 488
Target Start/End: Original strand, 9372340 - 9372387
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgc |
488 |
Q |
| |
|
||||||| || |||||||||||||||||| || |||||||||||||||| |
|
|
| T |
9372340 |
tttttggtgggggccggggtttgaacccc-gaacttgcatatattatgc |
9372387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Complemental strand, 12215820 - 12215780
Alignment:
| Q |
450 |
tggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| | ||||||||||||| |||||||||||||||||| |
|
|
| T |
12215820 |
tggccgtgatttgaaccccggaccttgcatatattatgcat |
12215780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 438 - 486
Target Start/End: Original strand, 27928088 - 27928136
Alignment:
| Q |
438 |
tctttttggcggtggccggggtttgaaccccggatcttgcatatattat |
486 |
Q |
| |
|
||||||| |||||||| | |||||||| |||||| |||||||||||||| |
|
|
| T |
27928088 |
tcttttttgcggtggctgaggtttgaatcccggaccttgcatatattat |
27928136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 62)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 49041973 - 49042015
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49041973 |
ggtggccggggtttgaaccccggaccttgcatatattatgcat |
49042015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 54857599 - 54857649
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
54857599 |
tttttggtggtggccggggtttgaaccccggaccttgcatattttatgcat |
54857649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 448 - 488
Target Start/End: Complemental strand, 11198397 - 11198357
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgc |
488 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11198397 |
ggtggccggggtttgaaccccggaccttgcatatattatgc |
11198357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 438 - 490
Target Start/End: Original strand, 49385288 - 49385340
Alignment:
| Q |
438 |
tctttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||| |||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
49385288 |
tctttttggtggtggccgaggtttgaactccggatcttacatatattatgcat |
49385340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 435 - 490
Target Start/End: Complemental strand, 42139926 - 42139871
Alignment:
| Q |
435 |
tactctttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
42139926 |
tacttttttttgcggtggccggggtttgaaccccggacattgcatgtattatgcat |
42139871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 3936696 - 3936654
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
3936696 |
ggtggccggggttcgaaccccggaccttgcatatattatgcat |
3936654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 7230349 - 7230307
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
7230349 |
ggtggccgaggtttgaaccccggaccttgcatatattatgcat |
7230307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 8027389 - 8027431
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8027389 |
ggtggtcggggtttgaacccccgatcttgcatatattatgcat |
8027431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 9946504 - 9946454
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||| |||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
9946504 |
tttttggtggtggtcggggtttgaaccccggaccttgcatattttatgcat |
9946454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 11949755 - 11949797
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11949755 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcat |
11949797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 19479469 - 19479511
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19479469 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcat |
19479511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 20799378 - 20799428
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||| || |||||||||||||||| |||||||||||||||||| |
|
|
| T |
20799378 |
tttttggtggtgaccagggtttgaaccccggaccttgcatatattatgcat |
20799428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 28435232 - 28435282
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||| ||||||||||||||| | |||||||||||||||||| |
|
|
| T |
28435232 |
tttttggtggtggctggggtttgaaccccgaaccttgcatatattatgcat |
28435282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 43034326 - 43034376
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||||||||||||||| | || |||||||||||||||||| |
|
|
| T |
43034326 |
tttttggtggtggccggggtttgaacctcagaccttgcatatattatgcat |
43034376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 449 - 487
Target Start/End: Original strand, 47814244 - 47814282
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47814244 |
gtggccggggtttgaaccccggaccttgcatatattatg |
47814282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 54294414 - 54294456
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54294414 |
ggtgtccggggtttgaaccccggaccttgcatatattatgcat |
54294456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 56551584 - 56551626
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
56551584 |
ggtggccggggtttgaacctcggaccttgcatatattatgcat |
56551626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 440 - 488
Target Start/End: Original strand, 23304000 - 23304048
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgc |
488 |
Q |
| |
|
||||||| ||||||||||||| | |||||||| |||||||||||||||| |
|
|
| T |
23304000 |
tttttggtggtggccggggttcgcaccccggaccttgcatatattatgc |
23304048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 44816004 - 44815968
Alignment:
| Q |
454 |
cggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44816004 |
cggggtttgaaccccggaccttgcatatattatgcat |
44815968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 442 - 490
Target Start/End: Original strand, 49952657 - 49952705
Alignment:
| Q |
442 |
tttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||| |||||||| | || |||||||||||||||||| |
|
|
| T |
49952657 |
tttggcggtggccgggatttgaaccactgaccttgcatatattatgcat |
49952705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Complemental strand, 675980 - 675945
Alignment:
| Q |
455 |
ggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
675980 |
ggggtttgaaccccggaccttgcatatattatgcat |
675945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 448 - 487
Target Start/End: Complemental strand, 10035334 - 10035295
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
10035334 |
ggtggccggggtttgaaccccagaccttgcatatattatg |
10035295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Complemental strand, 20383550 - 20383515
Alignment:
| Q |
455 |
ggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20383550 |
ggggtttgaaccccggaccttgcatatattatgcat |
20383515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 432 - 487
Target Start/End: Complemental strand, 33495650 - 33495595
Alignment:
| Q |
432 |
atatactctttttggcggtggccggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
|||| |||||||||| ||||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
33495650 |
atatcctctttttggtggtggttggggtttgaaccctgaatcttgcatatattatg |
33495595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 451 - 490
Target Start/End: Original strand, 50152233 - 50152272
Alignment:
| Q |
451 |
ggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
50152233 |
ggccggggtttgaaccccgaaccttgcatatattatgcat |
50152272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 486
Target Start/End: Complemental strand, 2888943 - 2888905
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattat |
486 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
2888943 |
ggtggccggggtttgaaccgcggaccttgcatatattat |
2888905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 6087816 - 6087774
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
6087816 |
ggtggctggggtttgaaccccagaccttgcatatattatgcat |
6087774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8495056 - 8495014
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||| ||||||| | |||||||||||||||||||||| |
|
|
| T |
8495056 |
ggtggccgggatttgaactcgggatcttgcatatattatgcat |
8495014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 10261761 - 10261803
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
10261761 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
10261803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 10303495 - 10303545
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
10303495 |
tttttggtagtggccgaggttcgaaccccggatcttgcatattttatgcat |
10303545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 12322742 - 12322700
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| | ||||||||||||||| |||||||||||||||||| |
|
|
| T |
12322742 |
ggtggctgaggtttgaaccccggaacttgcatatattatgcat |
12322700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 16304090 - 16304132
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
16304090 |
ggtggccgcggtttgaatcccggaccttgcatatattatgcat |
16304132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 17423169 - 17423211
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| || |||||||||||||| |||||||||||||||||| |
|
|
| T |
17423169 |
ggtggctggagtttgaaccccggaccttgcatatattatgcat |
17423211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 19588223 - 19588181
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
19588223 |
ggtggccggggtttgaaccctggaccttgcatattttatgcat |
19588181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 19854634 - 19854592
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| ||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
19854634 |
ggtgtccgaggttcgaaccccggatcttgcatatattatgcat |
19854592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 21114297 - 21114339
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
21114297 |
ggtggtcggggtttgaaccccggaccttgcatatatcatgcat |
21114339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 21562694 - 21562652
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
21562694 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
21562652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 24664983 - 24665025
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
24664983 |
ggtggtcggggttcgaaccccggaccttgcatatattatgcat |
24665025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 26926702 - 26926744
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
26926702 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
26926744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 486
Target Start/End: Complemental strand, 29701157 - 29701119
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattat |
486 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
29701157 |
ggtggccggagtttgaaccccggaacttgcatatattat |
29701119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 35287499 - 35287541
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
35287499 |
ggtggccggggttggaaccccggaccttgcatattttatgcat |
35287541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 36490637 - 36490595
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
36490637 |
ggtggtcgggatttgaaccccggatcttgcatacattatgcat |
36490595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 452 - 490
Target Start/End: Complemental strand, 37921811 - 37921773
Alignment:
| Q |
452 |
gccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
37921811 |
gccggggtttgaatcccggaccttgcatatattatgcat |
37921773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 38375026 - 38374984
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| || || |||||||||||||||||| |
|
|
| T |
38375026 |
ggtggccggggtttgaactccagaccttgcatatattatgcat |
38374984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 38453342 - 38453292
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||| |||||| |||||| ||| |||||||||||||||||| |
|
|
| T |
38453342 |
tttttggtggtggctggggttcgaaccctggaccttgcatatattatgcat |
38453292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 43330215 - 43330173
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
43330215 |
ggtggccggggtttgaactccggaccttgcatattttatgcat |
43330173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 44732577 - 44732527
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||| | |||||||||||||| ||||||||||| |||||||| |
|
|
| T |
44732577 |
tttttggtggtggtcagggtttgaaccccgtatcttgcatattttatgcat |
44732527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 51450281 - 51450239
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
51450281 |
ggtggccggggtttgaactccggaccttgcatatcttatgcat |
51450239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 56497592 - 56497642
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||| || ||||||| || |||||||||||||||||| |
|
|
| T |
56497592 |
tttttggtggtggccgggattcgaaccccagaccttgcatatattatgcat |
56497642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 457 - 490
Target Start/End: Original strand, 14197432 - 14197465
Alignment:
| Q |
457 |
ggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
14197432 |
ggtttgaaccccggatcttacatatattatgcat |
14197465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 14202472 - 14202513
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
14202472 |
gtggtcggggtttgaaccccggaccttacatatattatgcat |
14202513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 448 - 489
Target Start/End: Complemental strand, 17729495 - 17729454
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgca |
489 |
Q |
| |
|
||||| ||||||||||||||| || ||||||||||||||||| |
|
|
| T |
17729495 |
ggtggtcggggtttgaaccccagaccttgcatatattatgca |
17729454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 453 - 490
Target Start/End: Original strand, 25783446 - 25783483
Alignment:
| Q |
453 |
ccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
25783446 |
ccggagtttgaaccccggaccttgcatatattatgcat |
25783483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 453 - 490
Target Start/End: Complemental strand, 28568269 - 28568232
Alignment:
| Q |
453 |
ccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
28568269 |
ccggggtttgaaccccgaatcttgtatatattatgcat |
28568232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 441 - 490
Target Start/End: Complemental strand, 34042316 - 34042267
Alignment:
| Q |
441 |
ttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| ||||| || ||||||||||||| | |||||||||||||||||| |
|
|
| T |
34042316 |
ttttggtggtggtcgaggtttgaaccccgaaccttgcatatattatgcat |
34042267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 48226760 - 48226719
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||| |||||||| |
|
|
| T |
48226760 |
gtggccggagtttgaaccccggaccttgcatattttatgcat |
48226719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Original strand, 14577501 - 14577541
Alignment:
| Q |
450 |
tggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
14577501 |
tggccggggtttgaactccggactttgcatatattatgcat |
14577541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Complemental strand, 23154661 - 23154621
Alignment:
| Q |
450 |
tggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
23154661 |
tggccggggtttgaactccgaatcttgcatattttatgcat |
23154621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 448 - 488
Target Start/End: Original strand, 23247590 - 23247630
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgc |
488 |
Q |
| |
|
|||||||||||||| |||||| || |||||||||||||||| |
|
|
| T |
23247590 |
ggtggccggggtttaaaccccagaccttgcatatattatgc |
23247630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 448 - 488
Target Start/End: Complemental strand, 23810018 - 23809978
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgc |
488 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||||||||| |
|
|
| T |
23810018 |
ggtggccggggtttgaaccctgaaccttgcatatattatgc |
23809978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 43155142 - 43155106
Alignment:
| Q |
454 |
cggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
43155142 |
cggggtttgaacctcagatcttgcatatattatgcat |
43155106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 458 - 490
Target Start/End: Original strand, 49953405 - 49953437
Alignment:
| Q |
458 |
gtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
49953405 |
gtttgaaccccggaccttgcatatattatgcat |
49953437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 44)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 34521174 - 34521224
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
34521174 |
tttttggtggtggccgaggtttgaaccccggaccttgcatatattatgcat |
34521224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 438 - 490
Target Start/End: Complemental strand, 27533322 - 27533270
Alignment:
| Q |
438 |
tctttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| | |||||||||||||||||| |
|
|
| T |
27533322 |
tctttttggtggtggtcggggtttgaaccccgaaccttgcatatattatgcat |
27533270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 1794665 - 1794623
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
1794665 |
ggtggtcgaggtttgaaccccggatcttgcatatattatgcat |
1794623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 3481630 - 3481588
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
3481630 |
ggtggccggggtttgaaccccagaccttgcatatattatgcat |
3481588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 5907876 - 5907826
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
5907876 |
tttttggtggtgtccggggtttgaaccctggaccttgcatatattatgcat |
5907826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8736504 - 8736462
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
8736504 |
ggtggccggggtttgaaccccggaccttgcatattttatgcat |
8736462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 12212372 - 12212322
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12212372 |
ttttcggcggtggtcggggtttgaaccccggacgttgcatatattatgcat |
12212322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 17139501 - 17139551
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||| |||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
17139501 |
tttttggtggtggtcggggtttgaaccccggaccttgaatatattatgcat |
17139551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 452 - 490
Target Start/End: Complemental strand, 25533038 - 25533000
Alignment:
| Q |
452 |
gccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25533038 |
gccggggtttgaaccccggaccttgcatatattatgcat |
25533000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 34595941 - 34595899
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
34595941 |
ggtggccgaggtttgaaccccggaccttgcatatattatgcat |
34595899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 41973324 - 41973282
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
41973324 |
ggtggccggggttcgaaccccggaccttgcatatattatgcat |
41973282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 42045356 - 42045406
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||| || || |||||||||||||||||| |
|
|
| T |
42045356 |
tttttggtggtggccggggtttgaactccagaccttgcatatattatgcat |
42045406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 49431985 - 49432027
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
49431985 |
ggtggccggggtttgaaccccggaccttacatatattatgcat |
49432027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 12268977 - 12269018
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12268977 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
12269018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 17537755 - 17537714
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
17537755 |
gtggccggggtttgaacaccggatcttgtatatattatgcat |
17537714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 448 - 485
Target Start/End: Original strand, 19795108 - 19795145
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatatta |
485 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19795108 |
ggtggccggggtttgaaccccggaccttgcatatatta |
19795145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 41763148 - 41763189
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
41763148 |
gtggccggggtttgaaccccggaccttgcatattttatgcat |
41763189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 448 - 483
Target Start/End: Original strand, 6423753 - 6423788
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatat |
483 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6423753 |
ggtggccggggtttgaaccccggaccttgcatatat |
6423788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 448 - 487
Target Start/End: Original strand, 8269360 - 8269399
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
8269360 |
ggtggtcggggtttgaaccccggaccttgcatatattatg |
8269399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 5869833 - 5869791
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
5869833 |
ggtggtcggggtttgaactccgaatcttgcatatattatgcat |
5869791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 6000135 - 6000177
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
6000135 |
ggtgtccggggtttgaacctcggaccttgcatatattatgcat |
6000177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8094110 - 8094068
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||| ||||||| | |||||||||||||||||| |
|
|
| T |
8094110 |
ggtggccggggtttaaaccccgcaccttgcatatattatgcat |
8094068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 15854080 - 15854122
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
15854080 |
ggtggccgaggtttgaatcctggatcttgcatatattatgcat |
15854122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 16033442 - 16033484
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
16033442 |
ggtggccggagtttgaaccccagaccttgcatatattatgcat |
16033484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 18166679 - 18166629
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18166679 |
tttttggtagtggtcggggtttgaaccccggactttgcatatattatgcat |
18166629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 21638190 - 21638140
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||| |||||||| |||||||||| ||||||||||| |||||| |
|
|
| T |
21638190 |
tttttggtggtgtccggggttcgaaccccggaccttgcatatatcatgcat |
21638140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 456 - 490
Target Start/End: Original strand, 26256089 - 26256123
Alignment:
| Q |
456 |
gggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26256089 |
gggttcgaaccccggatcttgcatatattatgcat |
26256123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 29042606 - 29042564
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
29042606 |
ggtggtcgggatttgaaccccggatcttacatatattatgcat |
29042564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 29739414 - 29739364
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||| |||| ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
29739414 |
tttttggtggtagccgaggtttgaaccccggaccttgcatattttatgcat |
29739364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 32950745 - 32950795
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||| || ||||||||| ||||| |||||||||||||||||| |
|
|
| T |
32950745 |
tttttggtggtggtcgaggtttgaactccggaccttgcatatattatgcat |
32950795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 486
Target Start/End: Complemental strand, 34632238 - 34632200
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattat |
486 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
34632238 |
ggtggccgggatttgaacctcggatcttgcatatattat |
34632200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 486
Target Start/End: Original strand, 37810511 - 37810557
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattat |
486 |
Q |
| |
|
||||||| ||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
37810511 |
tttttggtggtggccagggtttgaaccccgtaccttgcatatattat |
37810557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 46707941 - 46707899
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
46707941 |
ggtggccgatgtttgaaccccggaacttgcatatattatgcat |
46707899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 486
Target Start/End: Complemental strand, 2994826 - 2994789
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattat |
486 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
2994826 |
gtggtcggggtttgaaccccggaccttgcatatattat |
2994789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 453 - 490
Target Start/End: Complemental strand, 11681287 - 11681250
Alignment:
| Q |
453 |
ccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| |
|
|
| T |
11681287 |
ccggggtttgaaccccagaccttgcatatattatgcat |
11681250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 15668566 - 15668525
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
15668566 |
gtggctggggtttgaaccccggaccttgcatattttatgcat |
15668525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 487
Target Start/End: Original strand, 3937521 - 3937553
Alignment:
| Q |
455 |
ggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
3937521 |
ggggtttgaaccccggaccttgcatatattatg |
3937553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 4302515 - 4302479
Alignment:
| Q |
454 |
cggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
4302515 |
cgggatttgaactccggatcttgcatatattatgcat |
4302479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 440 - 484
Target Start/End: Original strand, 23730363 - 23730407
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatatt |
484 |
Q |
| |
|
||||||| |||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
23730363 |
tttttggtggtgtccggggttcgaaccccggaccttgcatatatt |
23730407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 448 - 480
Target Start/End: Original strand, 24740832 - 24740864
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcata |
480 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
24740832 |
ggtggctggggtttgaaccccggatcttgcata |
24740864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Complemental strand, 26755683 - 26755643
Alignment:
| Q |
450 |
tggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
26755683 |
tggccgaggtttgaaccccggaccttgcatatataatgcat |
26755643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 487
Target Start/End: Original strand, 28016189 - 28016221
Alignment:
| Q |
455 |
ggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
28016189 |
ggggtttgaaccccggatcttgcatattttatg |
28016221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 442 - 490
Target Start/End: Original strand, 38448852 - 38448900
Alignment:
| Q |
442 |
tttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||| |||| ||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
38448852 |
tttggtggtgtccgggattcgaaccccggaccttgcatatattatgcat |
38448900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 449 - 481
Target Start/End: Complemental strand, 52086177 - 52086145
Alignment:
| Q |
449 |
gtggccggggtttgaaccccggatcttgcatat |
481 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
52086177 |
gtggtcggggtttgaaccccggatcttgcatat |
52086145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 185332 - 185290
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
185332 |
ggtgaccggggtttgaaccccggatcttgcatattttatgcat |
185290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 450 - 490
Target Start/End: Original strand, 1159 - 1199
Alignment:
| Q |
450 |
tggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1159 |
tggctggggtttgaaccccggaccttgcatatattatgcat |
1199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0983 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0983
Description:
Target: scaffold0983; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 440 - 487
Target Start/End: Original strand, 3299 - 3346
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatg |
487 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| | ||||||||||||||| |
|
|
| T |
3299 |
tttttggcagtggccgaggtttgaaccccgaaccttgcatatattatg |
3346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 31914 - 31956
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
31914 |
ggtggccggagtgtgaaccccggaccttgcatatattatgcat |
31956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 61554 - 61604
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| ||| |||| ||||||||| |
|
|
| T |
61554 |
tttttggtggtggccggggtttgaaccctggaccttacatacattatgcat |
61604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 75394 - 75352
Alignment:
| Q |
448 |
ggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
75394 |
ggtggccgggattcgaaccccggaccttgcatatattatgcat |
75352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 161218 - 161168
Alignment:
| Q |
440 |
tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
||||||| ||||| |||||||||||||||| | ||||||||| |||||||| |
|
|
| T |
161218 |
tttttggtggtggtcggggtttgaaccccgaaccttgcatattttatgcat |
161168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Complemental strand, 239874 - 239834
Alignment:
| Q |
450 |
tggccggggtttgaaccccggatcttgcatatattatgcat |
490 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
239874 |
tggccggggtttgaactccggactttgcatatattatgcat |
239834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University