View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21221_low_2 (Length: 490)

Name: NF21221_low_2
Description: NF21221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21221_low_2
NF21221_low_2
[»] chr5 (41 HSPs)
chr5 (1-266)||(27219019-27219282)
chr5 (284-487)||(27219318-27219523)
chr5 (79-257)||(27216690-27216870)
chr5 (440-490)||(22522785-22522835)
chr5 (284-336)||(27216970-27217022)
chr5 (440-490)||(6489034-6489084)
chr5 (440-490)||(6624803-6624853)
chr5 (448-490)||(40715941-40715983)
chr5 (444-490)||(16094084-16094130)
chr5 (440-486)||(22665187-22665233)
chr5 (440-490)||(26655491-26655541)
chr5 (440-490)||(26927076-26927126)
chr5 (440-490)||(32339762-32339812)
chr5 (440-490)||(34191460-34191510)
chr5 (440-485)||(4009899-4009944)
chr5 (441-490)||(34436878-34436927)
chr5 (449-490)||(42473921-42473962)
chr5 (442-490)||(3445233-3445281)
chr5 (448-488)||(14474863-14474903)
chr5 (438-490)||(37932357-37932409)
chr5 (443-490)||(11720921-11720967)
chr5 (448-487)||(13864374-13864413)
chr5 (455-490)||(31877955-31877990)
chr5 (440-490)||(15889438-15889488)
chr5 (448-490)||(17090893-17090935)
chr5 (448-490)||(18147745-18147787)
chr5 (448-490)||(18331734-18331776)
chr5 (440-490)||(20688067-20688117)
chr5 (440-490)||(24408522-24408572)
chr5 (448-490)||(25979871-25979913)
chr5 (448-490)||(31280046-31280088)
chr5 (448-490)||(32200439-32200481)
chr5 (448-490)||(37021364-37021406)
chr5 (448-490)||(37462138-37462180)
chr5 (440-490)||(39980535-39980585)
chr5 (454-487)||(20721080-20721113)
chr5 (449-490)||(33412118-33412159)
chr5 (458-490)||(3389189-3389221)
chr5 (454-490)||(21139146-21139182)
chr5 (440-484)||(31958452-31958496)
chr5 (457-485)||(38976702-38976730)
[»] chr8 (34 HSPs)
chr8 (440-490)||(12748928-12748978)
chr8 (440-489)||(32286348-32286397)
chr8 (442-490)||(32051518-32051566)
chr8 (440-490)||(13286158-13286207)
chr8 (440-486)||(15020792-15020838)
chr8 (440-490)||(19260563-19260613)
chr8 (440-490)||(24838154-24838204)
chr8 (440-490)||(27587248-27587298)
chr8 (440-490)||(30176403-30176453)
chr8 (455-490)||(18533696-18533731)
chr8 (448-490)||(444440-444482)
chr8 (448-490)||(8881302-8881344)
chr8 (440-490)||(10601790-10601840)
chr8 (441-487)||(12800885-12800931)
chr8 (440-490)||(22775655-22775705)
chr8 (448-490)||(23159468-23159510)
chr8 (440-490)||(33105418-33105468)
chr8 (440-490)||(44794920-44794970)
chr8 (450-490)||(13124357-13124397)
chr8 (443-490)||(6471538-6471585)
chr8 (455-490)||(42172242-42172277)
chr8 (448-490)||(3650547-3650589)
chr8 (448-490)||(6235543-6235585)
chr8 (448-490)||(8717467-8717509)
chr8 (440-490)||(13357425-13357475)
chr8 (440-490)||(15001259-15001309)
chr8 (448-490)||(19163528-19163570)
chr8 (448-490)||(20665355-20665397)
chr8 (448-490)||(30550718-30550760)
chr8 (448-490)||(37141384-37141426)
chr8 (448-490)||(44215467-44215509)
chr8 (449-490)||(24023408-24023449)
chr8 (448-488)||(7996969-7997009)
chr8 (450-490)||(10871888-10871928)
[»] chr3 (48 HSPs)
chr3 (440-490)||(38130943-38130993)
chr3 (438-490)||(48849745-48849797)
chr3 (448-487)||(11358264-11358303)
chr3 (440-490)||(4601871-4601921)
chr3 (440-490)||(25340908-25340958)
chr3 (448-490)||(51882192-51882234)
chr3 (454-490)||(10922306-10922342)
chr3 (448-490)||(334839-334881)
chr3 (440-490)||(913584-913634)
chr3 (448-490)||(14827552-14827594)
chr3 (440-490)||(16792958-16793008)
chr3 (448-490)||(25441492-25441534)
chr3 (440-490)||(29631213-29631263)
chr3 (448-490)||(34899124-34899166)
chr3 (440-490)||(41817526-41817576)
chr3 (448-490)||(45431975-45432017)
chr3 (441-490)||(22251445-22251494)
chr3 (438-490)||(55066582-55066634)
chr3 (448-490)||(916466-916508)
chr3 (448-490)||(7464483-7464525)
chr3 (448-490)||(8075812-8075854)
chr3 (448-490)||(8113554-8113596)
chr3 (448-490)||(8238591-8238633)
chr3 (448-490)||(10102826-10102868)
chr3 (448-490)||(10213749-10213791)
chr3 (456-490)||(16663236-16663270)
chr3 (440-490)||(17262204-17262253)
chr3 (440-490)||(20612261-20612311)
chr3 (448-490)||(25727959-25728001)
chr3 (448-490)||(30050420-30050462)
chr3 (448-490)||(32843254-32843296)
chr3 (440-490)||(35191801-35191851)
chr3 (440-490)||(38602985-38603035)
chr3 (448-490)||(44075148-44075190)
chr3 (440-490)||(45334216-45334266)
chr3 (448-490)||(48796210-48796252)
chr3 (448-490)||(52119403-52119445)
chr3 (448-490)||(54243412-54243454)
chr3 (440-489)||(552202-552251)
chr3 (449-490)||(34442440-34442481)
chr3 (453-490)||(35126266-35126303)
chr3 (443-488)||(35210118-35210163)
chr3 (438-487)||(35863795-35863844)
chr3 (448-489)||(45885469-45885510)
chr3 (449-490)||(48315017-48315058)
chr3 (457-490)||(48656900-48656933)
chr3 (440-481)||(53365940-53365981)
chr3 (458-490)||(24120422-24120454)
[»] chr2 (56 HSPs)
chr2 (440-490)||(10735815-10735865)
chr2 (440-490)||(29544654-29544704)
chr2 (443-490)||(27848185-27848232)
chr2 (440-490)||(24592830-24592880)
chr2 (440-490)||(42791322-42791372)
chr2 (440-489)||(27411120-27411169)
chr2 (440-487)||(44810735-44810782)
chr2 (448-490)||(11175812-11175854)
chr2 (440-490)||(16390630-16390680)
chr2 (448-490)||(20200732-20200774)
chr2 (448-490)||(25186234-25186276)
chr2 (440-490)||(28771609-28771659)
chr2 (448-490)||(31815879-31815921)
chr2 (449-490)||(18693655-18693696)
chr2 (449-490)||(22709112-22709153)
chr2 (455-490)||(20565074-20565109)
chr2 (455-490)||(31543039-31543074)
chr2 (448-490)||(660814-660856)
chr2 (448-490)||(2256998-2257040)
chr2 (448-490)||(3708720-3708762)
chr2 (440-490)||(4180724-4180774)
chr2 (450-488)||(4927443-4927481)
chr2 (440-490)||(5168563-5168613)
chr2 (448-490)||(8728846-8728888)
chr2 (440-490)||(9516993-9517043)
chr2 (448-490)||(10723966-10724008)
chr2 (448-490)||(11868654-11868696)
chr2 (448-490)||(11931632-11931674)
chr2 (448-490)||(15447706-15447748)
chr2 (448-490)||(20455918-20455960)
chr2 (448-490)||(23250312-23250354)
chr2 (448-490)||(30089076-30089118)
chr2 (448-490)||(30125680-30125722)
chr2 (440-490)||(30243277-30243327)
chr2 (440-490)||(33064013-33064063)
chr2 (448-490)||(34977231-34977273)
chr2 (448-490)||(35360047-35360089)
chr2 (448-490)||(35820293-35820335)
chr2 (448-490)||(36359341-36359383)
chr2 (440-490)||(36474789-36474839)
chr2 (440-490)||(41778928-41778978)
chr2 (448-490)||(41859879-41859921)
chr2 (448-490)||(44526155-44526197)
chr2 (449-490)||(8781643-8781684)
chr2 (449-490)||(11551195-11551236)
chr2 (449-490)||(40853811-40853852)
chr2 (450-490)||(7206152-7206192)
chr2 (458-490)||(8091160-8091192)
chr2 (440-488)||(10811097-10811145)
chr2 (454-490)||(29734718-29734754)
chr2 (442-490)||(29896280-29896328)
chr2 (442-490)||(31476998-31477046)
chr2 (446-490)||(33567688-33567732)
chr2 (450-490)||(41763872-41763912)
chr2 (440-488)||(42754074-42754122)
chr2 (450-490)||(44694715-44694755)
[»] chr7 (39 HSPs)
chr7 (448-490)||(14046603-14046645)
chr7 (448-490)||(14356633-14356675)
chr7 (440-490)||(19416541-19416591)
chr7 (448-490)||(27462428-27462470)
chr7 (440-490)||(8084454-8084504)
chr7 (440-490)||(18714475-18714525)
chr7 (448-490)||(19599172-19599214)
chr7 (440-490)||(21322202-21322252)
chr7 (440-490)||(36121679-36121729)
chr7 (448-490)||(42829226-42829268)
chr7 (440-485)||(145550-145595)
chr7 (449-490)||(19626518-19626559)
chr7 (449-490)||(46737812-46737853)
chr7 (441-488)||(2512338-2512385)
chr7 (455-490)||(20085758-20085793)
chr7 (448-490)||(3830095-3830137)
chr7 (456-490)||(10244754-10244788)
chr7 (448-490)||(20763181-20763223)
chr7 (440-482)||(21174394-21174436)
chr7 (448-490)||(27833393-27833435)
chr7 (448-490)||(29488747-29488789)
chr7 (440-490)||(31038506-31038556)
chr7 (448-490)||(33232389-33232431)
chr7 (440-490)||(33473505-33473555)
chr7 (448-490)||(34284531-34284573)
chr7 (440-490)||(39801733-39801783)
chr7 (448-490)||(42095935-42095977)
chr7 (440-490)||(43346548-43346598)
chr7 (448-490)||(46987113-46987155)
chr7 (448-490)||(48629057-48629099)
chr7 (448-489)||(5579721-5579762)
chr7 (457-490)||(7670461-7670494)
chr7 (449-490)||(10421990-10422031)
chr7 (453-486)||(23147321-23147354)
chr7 (448-489)||(42753519-42753560)
chr7 (441-490)||(46371008-46371057)
chr7 (462-490)||(1285075-1285103)
chr7 (454-490)||(10242507-10242543)
chr7 (458-490)||(39280820-39280852)
[»] chr6 (34 HSPs)
chr6 (448-490)||(8569736-8569778)
chr6 (440-490)||(655733-655783)
chr6 (440-490)||(7082976-7083026)
chr6 (440-490)||(27907935-27907985)
chr6 (448-490)||(29740509-29740551)
chr6 (448-490)||(33824908-33824950)
chr6 (449-490)||(2655020-2655061)
chr6 (454-490)||(8809333-8809369)
chr6 (450-490)||(33976271-33976311)
chr6 (455-490)||(291394-291429)
chr6 (440-487)||(17151266-17151313)
chr6 (447-490)||(28898883-28898926)
chr6 (448-490)||(247686-247728)
chr6 (441-487)||(2546210-2546256)
chr6 (448-490)||(2726409-2726451)
chr6 (448-490)||(12184535-12184577)
chr6 (440-490)||(13496143-13496193)
chr6 (448-490)||(15187090-15187132)
chr6 (448-490)||(15473474-15473516)
chr6 (448-490)||(16390456-16390498)
chr6 (448-490)||(24373702-24373744)
chr6 (448-490)||(28231417-28231459)
chr6 (440-490)||(34481398-34481448)
chr6 (449-490)||(2692242-2692283)
chr6 (441-490)||(10018426-10018475)
chr6 (449-490)||(20744165-20744206)
chr6 (449-490)||(26356074-26356115)
chr6 (441-486)||(26548282-26548327)
chr6 (442-490)||(2445326-2445374)
chr6 (448-488)||(4455588-4455628)
chr6 (454-490)||(9111074-9111110)
chr6 (440-488)||(9372340-9372387)
chr6 (450-490)||(12215780-12215820)
chr6 (438-486)||(27928088-27928136)
[»] chr4 (62 HSPs)
chr4 (448-490)||(49041973-49042015)
chr4 (440-490)||(54857599-54857649)
chr4 (448-488)||(11198357-11198397)
chr4 (438-490)||(49385288-49385340)
chr4 (435-490)||(42139871-42139926)
chr4 (448-490)||(3936654-3936696)
chr4 (448-490)||(7230307-7230349)
chr4 (448-490)||(8027389-8027431)
chr4 (440-490)||(9946454-9946504)
chr4 (448-490)||(11949755-11949797)
chr4 (448-490)||(19479469-19479511)
chr4 (440-490)||(20799378-20799428)
chr4 (440-490)||(28435232-28435282)
chr4 (440-490)||(43034326-43034376)
chr4 (449-487)||(47814244-47814282)
chr4 (448-490)||(54294414-54294456)
chr4 (448-490)||(56551584-56551626)
chr4 (440-488)||(23304000-23304048)
chr4 (454-490)||(44815968-44816004)
chr4 (442-490)||(49952657-49952705)
chr4 (455-490)||(675945-675980)
chr4 (448-487)||(10035295-10035334)
chr4 (455-490)||(20383515-20383550)
chr4 (432-487)||(33495595-33495650)
chr4 (451-490)||(50152233-50152272)
chr4 (448-486)||(2888905-2888943)
chr4 (448-490)||(6087774-6087816)
chr4 (448-490)||(8495014-8495056)
chr4 (448-490)||(10261761-10261803)
chr4 (440-490)||(10303495-10303545)
chr4 (448-490)||(12322700-12322742)
chr4 (448-490)||(16304090-16304132)
chr4 (448-490)||(17423169-17423211)
chr4 (448-490)||(19588181-19588223)
chr4 (448-490)||(19854592-19854634)
chr4 (448-490)||(21114297-21114339)
chr4 (448-490)||(21562652-21562694)
chr4 (448-490)||(24664983-24665025)
chr4 (448-490)||(26926702-26926744)
chr4 (448-486)||(29701119-29701157)
chr4 (448-490)||(35287499-35287541)
chr4 (448-490)||(36490595-36490637)
chr4 (452-490)||(37921773-37921811)
chr4 (448-490)||(38374984-38375026)
chr4 (440-490)||(38453292-38453342)
chr4 (448-490)||(43330173-43330215)
chr4 (440-490)||(44732527-44732577)
chr4 (448-490)||(51450239-51450281)
chr4 (440-490)||(56497592-56497642)
chr4 (457-490)||(14197432-14197465)
chr4 (449-490)||(14202472-14202513)
chr4 (448-489)||(17729454-17729495)
chr4 (453-490)||(25783446-25783483)
chr4 (453-490)||(28568232-28568269)
chr4 (441-490)||(34042267-34042316)
chr4 (449-490)||(48226719-48226760)
chr4 (450-490)||(14577501-14577541)
chr4 (450-490)||(23154621-23154661)
chr4 (448-488)||(23247590-23247630)
chr4 (448-488)||(23809978-23810018)
chr4 (454-490)||(43155106-43155142)
chr4 (458-490)||(49953405-49953437)
[»] chr1 (44 HSPs)
chr1 (440-490)||(34521174-34521224)
chr1 (438-490)||(27533270-27533322)
chr1 (448-490)||(1794623-1794665)
chr1 (448-490)||(3481588-3481630)
chr1 (440-490)||(5907826-5907876)
chr1 (448-490)||(8736462-8736504)
chr1 (440-490)||(12212322-12212372)
chr1 (440-490)||(17139501-17139551)
chr1 (452-490)||(25533000-25533038)
chr1 (448-490)||(34595899-34595941)
chr1 (448-490)||(41973282-41973324)
chr1 (440-490)||(42045356-42045406)
chr1 (448-490)||(49431985-49432027)
chr1 (449-490)||(12268977-12269018)
chr1 (449-490)||(17537714-17537755)
chr1 (448-485)||(19795108-19795145)
chr1 (449-490)||(41763148-41763189)
chr1 (448-483)||(6423753-6423788)
chr1 (448-487)||(8269360-8269399)
chr1 (448-490)||(5869791-5869833)
chr1 (448-490)||(6000135-6000177)
chr1 (448-490)||(8094068-8094110)
chr1 (448-490)||(15854080-15854122)
chr1 (448-490)||(16033442-16033484)
chr1 (440-490)||(18166629-18166679)
chr1 (440-490)||(21638140-21638190)
chr1 (456-490)||(26256089-26256123)
chr1 (448-490)||(29042564-29042606)
chr1 (440-490)||(29739364-29739414)
chr1 (440-490)||(32950745-32950795)
chr1 (448-486)||(34632200-34632238)
chr1 (440-486)||(37810511-37810557)
chr1 (448-490)||(46707899-46707941)
chr1 (449-486)||(2994789-2994826)
chr1 (453-490)||(11681250-11681287)
chr1 (449-490)||(15668525-15668566)
chr1 (455-487)||(3937521-3937553)
chr1 (454-490)||(4302479-4302515)
chr1 (440-484)||(23730363-23730407)
chr1 (448-480)||(24740832-24740864)
chr1 (450-490)||(26755643-26755683)
chr1 (455-487)||(28016189-28016221)
chr1 (442-490)||(38448852-38448900)
chr1 (449-481)||(52086145-52086177)
[»] scaffold0011 (1 HSPs)
scaffold0011 (448-490)||(185290-185332)
[»] scaffold1127 (1 HSPs)
scaffold1127 (450-490)||(1159-1199)
[»] scaffold0983 (1 HSPs)
scaffold0983 (440-487)||(3299-3346)
[»] scaffold0038 (1 HSPs)
scaffold0038 (448-490)||(31914-31956)
[»] scaffold0027 (1 HSPs)
scaffold0027 (440-490)||(61554-61604)
[»] scaffold0026 (1 HSPs)
scaffold0026 (448-490)||(75352-75394)
[»] scaffold0021 (1 HSPs)
scaffold0021 (440-490)||(161168-161218)
[»] scaffold0005 (1 HSPs)
scaffold0005 (450-490)||(239834-239874)


Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 41)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 27219019 - 27219282
Alignment:
Q  1 tctctagtttaaagtctagaccaaaatctatttataatcgtctgtgcatctgccattgtgannnnnnnnnnnncttccattattttgatatatcataact 100  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||            |||||||||||||||||||||||||||    
T  27219019 tctctagtttaaagtctagaccacaatctatttataatcgtctgtgcatctgccattgtgatttttttttt--cttccattattttgatatatcataact 27219116  T
Q  101 tttgattgcttttagggtaagaatacatatatctaccctccccaaactctaccttacgggagccacgcgcactgggtcaccctatataatttctgattgc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27219117 tttgattgcttttagggtaagaatacatatatctaccctccccaaactcaaccttacgggagccacgcgcactgggtcaccctatataatttctgattgc 27219216  T
Q  201 ttagacacgtatttaagaattgtgcattcttcaatgtgcatggtatttgtatagagtgtgactatg 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27219217 ttagacacgtatttaagaattgtgcattcttcaatgtgcatggtatttgtatagagtgtgactatg 27219282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 284 - 487
Target Start/End: Complemental strand, 27219523 - 27219318
Alignment:
Q  284 ttgtggtatgatttggttgaatgtatgcgtcaaacagttttacattgtctgatacaactataacaaattaataattaatatattaagtgtaacttttaaa 383  Q
    |||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  27219523 ttgtggtatgatttggttgaatgtatgcgtaaaacagttttacattgcctgatacaactataacaaattaataattaatatcttaagtgtaacttttaaa 27219424  T
Q  384 tgtgtgattgtgtctgtagtccatgtttgttgtgtttccccatagtcgatatactct--ttttggcggtggccggggtttgaaccccggatcttgcatat 481  Q
    ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||  ||||||||||||||||||||||||||| ||||||| |||||    
T  27219423 tgtatgattgtgtctgtagtccatgtttgttgtgttttcccatagtcgatatactctttttttggcggtggccggggtttgaaccctggatcttacatat 27219324  T
Q  482 attatg 487  Q
    ||||||    
T  27219323 attatg 27219318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 79 - 257
Target Start/End: Original strand, 27216690 - 27216870
Alignment:
Q  79 attattttgatatatcataacttttgattgcttttagggtaagaatacatatatctaccctccccaaactctaccttacgggagccacgcgcactgggtc 178  Q
    ||||||||||||||||||||||||||||||||| ||| |||||| | |||| ||||||||||| |||||||||||||| ||||||| ||  ||||| | |    
T  27216690 attattttgatatatcataacttttgattgcttctagtgtaagactgcatacatctaccctccacaaactctaccttatgggagcctcgtacactgagcc 27216789  T
Q  179 accctatataatttctgattgct--tagacacgtatttaagaattgtgcattcttcaatgtgcatggtatttgtatagagt 257  Q
    ||||| |||||||||||||||||  || |||| |||||||||||||  ||||||||||| ||||||||||| |||||||||    
T  27216790 accctttataatttctgattgcttatacacacctatttaagaattgcccattcttcaatatgcatggtattagtatagagt 27216870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 22522785 - 22522835
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||||||| ||||||||||||||||||    
T  22522785 tttttggtggtggccggggtttgaaccccggaccttgcatatattatgcat 22522835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 284 - 336
Target Start/End: Complemental strand, 27217022 - 27216970
Alignment:
Q  284 ttgtggtatgatttggttgaatgtatgcgtcaaacagttttacattgtctgat 336  Q
    ||||||||| |||||||||||||||||||| ||||||||||||| ||||||||    
T  27217022 ttgtggtataatttggttgaatgtatgcgtaaaacagttttacaatgtctgat 27216970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 6489084 - 6489034
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||||||||||||||||| || ||||||||||||||||||    
T  6489084 tttttggtggtggccggggtttgaaccccagaccttgcatatattatgcat 6489034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 6624853 - 6624803
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||||||||| |||||||||| ||||||||||||||||||    
T  6624853 tttttggtggtggccggggttcgaaccccggaccttgcatatattatgcat 6624803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 40715941 - 40715983
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||||| ||||||||||||||||||    
T  40715941 ggtggccggggtttgaaccccggaccttgcatatattatgcat 40715983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 444 - 490
Target Start/End: Complemental strand, 16094130 - 16094084
Alignment:
Q  444 tggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||| ||||||||||||||| |||||| ||||||||||||||    
T  16094130 tggcggtggtcggggtttgaaccccagatcttacatatattatgcat 16094084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 486
Target Start/End: Original strand, 22665187 - 22665233
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattat 486  Q
    ||||||| |||||||||||||||||| ||||||||||||||| ||||    
T  22665187 tttttggtggtggccggggtttgaactccggatcttgcatattttat 22665233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 26655541 - 26655491
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||||||||| |||||||||| ||| ||||||||||||||    
T  26655541 tttttggtggtggccggggttcgaaccccggaccttacatatattatgcat 26655491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 26927126 - 26927076
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||||||||| |||||||||| ||| ||||||||||||||    
T  26927126 tttttggtggtggccggggttcgaaccccggaccttacatatattatgcat 26927076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 32339812 - 32339762
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||| || |||||||||| ||||||||||||||||||    
T  32339812 tttttggtggtggccgggattcgaaccccggaccttgcatatattatgcat 32339762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 34191510 - 34191460
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||  ||||||||||||||||||||||| ||||||||| ||||||||    
T  34191510 tttttggtagtggccggggtttgaaccccggaccttgcatattttatgcat 34191460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 440 - 485
Target Start/End: Complemental strand, 4009944 - 4009899
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatatta 485  Q
    ||||||| |||||||||||||||||||||||  |||||||||||||    
T  4009944 tttttggtggtggccggggtttgaaccccggcccttgcatatatta 4009899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 441 - 490
Target Start/End: Complemental strand, 34436927 - 34436878
Alignment:
Q  441 ttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| ||||| |||||||||||||||||  ||||||||||||||||||    
T  34436927 ttttggtggtgggcggggtttgaaccccggcccttgcatatattatgcat 34436878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 42473962 - 42473921
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||||||||||| ||||||||||||||||||    
T  42473962 gtggccgtggtttgaaccccggaccttgcatatattatgcat 42473921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 442 - 490
Target Start/End: Original strand, 3445233 - 3445281
Alignment:
Q  442 tttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||| ||||||||||||| |||||||| |||||||||    
T  3445233 tttggtggtggccgggatttgaaccccggaccttgcatacattatgcat 3445281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 448 - 488
Target Start/End: Complemental strand, 14474903 - 14474863
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgc 488  Q
    |||||||||||||||||||| ||| ||||||||||||||||    
T  14474903 ggtggccggggtttgaaccctggaccttgcatatattatgc 14474863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 438 - 490
Target Start/End: Complemental strand, 37932409 - 37932357
Alignment:
Q  438 tctttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| | ||||||| ||||| |||||||||| ||||||||||||||||||    
T  37932409 tcttttttgtggtggccagggttcgaaccccggaccttgcatatattatgcat 37932357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 443 - 490
Target Start/End: Complemental strand, 11720967 - 11720921
Alignment:
Q  443 ttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| ||||||||||||||||||||| || ||||||||||||||||||    
T  11720967 ttggtggtggccggggtttgaacccc-gaccttgcatatattatgcat 11720921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 448 - 487
Target Start/End: Complemental strand, 13864413 - 13864374
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatg 487  Q
    ||||| |||||||||||||||||| |||||||||||||||    
T  13864413 ggtggtcggggtttgaaccccggaccttgcatatattatg 13864374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Complemental strand, 31877990 - 31877955
Alignment:
Q  455 ggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||| |||||||||||||||||||||    
T  31877990 ggggtttgaacccctgatcttgcatatattatgcat 31877955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 15889488 - 15889438
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||| ||||||||||||||  || ||||||||||||||||||    
T  15889488 tttttggtggtggtcggggtttgaaccctagaccttgcatatattatgcat 15889438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 17090935 - 17090893
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||||| |||||||  |||||||||    
T  17090935 ggtggccggggtttgaaccccggaccttgcattaattatgcat 17090893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 18147787 - 18147745
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||||| |||||||||||||| ||||||||||||||||    
T  18147787 ggtgaccgggggttgaaccccggatcctgcatatattatgcat 18147745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 18331776 - 18331734
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||| |||||||||||| ||||||||| ||||||||    
T  18331776 ggtggccggggcttgaaccccggaccttgcatattttatgcat 18331734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 20688117 - 20688067
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||| | |||||||| ||||| ||||||||||||||||||    
T  20688117 tttttggtggtggccagagtttgaactccggaccttgcatatattatgcat 20688067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 24408572 - 24408522
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||  |||| ||||||||||||||| || ||||||||||||||||||    
T  24408572 tttttggtagtggtcggggtttgaaccccagaccttgcatatattatgcat 24408522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 25979913 - 25979871
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| ||||||||||||||| |||||||| |||||||||    
T  25979913 ggtggccgaggtttgaaccccggaccttgcatacattatgcat 25979871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 31280088 - 31280046
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| || |||||||||||||||| |||||||||||||||||    
T  31280088 ggtggtcgaggtttgaaccccggatattgcatatattatgcat 31280046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 32200439 - 32200481
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| ||||| |||||||||||| ||||||||||||||||||    
T  32200439 ggtggtcggggcttgaaccccggaccttgcatatattatgcat 32200481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 37021364 - 37021406
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||| | ||||||||||||||||||||    
T  37021364 ggtggtcggggtttgaaccctgaatcttgcatatattatgcat 37021406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 37462180 - 37462138
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  37462180 ggtggccggggtttgaactccggaccttgcatattttatgcat 37462138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 39980585 - 39980535
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||| |||||||||||| ||||| ||||||||| ||||||||    
T  39980585 tttttggtggtggtcggggtttgaactccggaccttgcatattttatgcat 39980535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 487
Target Start/End: Complemental strand, 20721113 - 20721080
Alignment:
Q  454 cggggtttgaaccccggatcttgcatatattatg 487  Q
    |||||||||||||||||| |||||||||||||||    
T  20721113 cggggtttgaaccccggaccttgcatatattatg 20721080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 33412159 - 33412118
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||| || ||| ||||||||||||||||||    
T  33412159 gtggccggggtttgaatcctggaccttgcatatattatgcat 33412118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 458 - 490
Target Start/End: Complemental strand, 3389221 - 3389189
Alignment:
Q  458 gtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||| |||||||||||||||||||||    
T  3389221 gtttgaaccccagatcttgcatatattatgcat 3389189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 490
Target Start/End: Original strand, 21139146 - 21139182
Alignment:
Q  454 cggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| ||||||||||||| ||||||||||||||||||    
T  21139146 cgggttttgaaccccggaccttgcatatattatgcat 21139182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 440 - 484
Target Start/End: Original strand, 31958452 - 31958496
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatatt 484  Q
    ||||||| |||| |||||||| |||||||||| ||||||||||||    
T  31958452 tttttggtggtgtccggggttcgaaccccggaccttgcatatatt 31958496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 485
Target Start/End: Original strand, 38976702 - 38976730
Alignment:
Q  457 ggtttgaaccccggatcttgcatatatta 485  Q
    |||||||||||||||||||||||||||||    
T  38976702 ggtttgaaccccggatcttgcatatatta 38976730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 34)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 12748978 - 12748928
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||||||| ||||||||||||||||||    
T  12748978 tttttggtggtggccggggtttgaaccccggaccttgcatatattatgcat 12748928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 440 - 489
Target Start/End: Original strand, 32286348 - 32286397
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgca 489  Q
    ||||||| |||||||||||||||||||||| |||||||||||||||||||    
T  32286348 tttttggtggtggccggggtttgaaccccgaatcttgcatatattatgca 32286397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 442 - 490
Target Start/End: Original strand, 32051518 - 32051566
Alignment:
Q  442 tttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||||||||||||| ||||||||||||||||||    
T  32051518 tttggtggtggccggggtttgaaccccggaccttgcatatattatgcat 32051566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 13286207 - 13286158
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||||||||||| ||||||||||||||||||||||    
T  13286207 ttttttgcggtggccggggtttgaaccc-ggatcttgcatatattatgcat 13286158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 486
Target Start/End: Complemental strand, 15020838 - 15020792
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattat 486  Q
    ||||||| ||||||| |||||||||||||||||||||||||||||||    
T  15020838 tttttggtggtggccagggtttgaaccccggatcttgcatatattat 15020792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 19260563 - 19260613
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||||||| ||| ||||||||||||||    
T  19260563 tttttggtggtggccggggtttgaaccccggaccttacatatattatgcat 19260613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 24838154 - 24838204
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||||||| ||||||||| ||||||||    
T  24838154 tttttggtggtggccggggtttgaaccccggaccttgcatattttatgcat 24838204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 27587298 - 27587248
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||||||| ||||||||||| ||||||    
T  27587298 tttttggtggtggccggggtttgaaccccggaccttgcatatatcatgcat 27587248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 30176403 - 30176453
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||| ||||||||||||||||||| ||||||||||||||||||    
T  30176403 tttttggtggtgtccggggtttgaaccccggaccttgcatatattatgcat 30176453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 455 - 490
Target Start/End: Complemental strand, 18533731 - 18533696
Alignment:
Q  455 ggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||||||||||||||||||||    
T  18533731 ggggtttgaaccccggatcttgcatatattatgcat 18533696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 444482 - 444440
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||| ||||||||| ||||||||||||||||||    
T  444482 ggtggccggggtttaaaccccggaccttgcatatattatgcat 444440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8881344 - 8881302
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||| ||| ||||||||||||||||||    
T  8881344 ggtggccggggtttgaaccctggaccttgcatatattatgcat 8881302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 10601840 - 10601790
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||  |||||||||||||||| |||| ||||||||||||||||||||    
T  10601840 tttttggttgtggccggggtttgaatcccgaatcttgcatatattatgcat 10601790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 441 - 487
Target Start/End: Original strand, 12800885 - 12800931
Alignment:
Q  441 ttttggcggtggccggggtttgaaccccggatcttgcatatattatg 487  Q
    |||||| ||||| |||||||||||||||||| |||||||||||||||    
T  12800885 ttttggtggtggtcggggtttgaaccccggaccttgcatatattatg 12800931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 22775705 - 22775655
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||| |||||||||||||||| |||||||| |||||||||    
T  22775705 tttttggtggtggccagggtttgaaccccggaccttgcataaattatgcat 22775655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 23159510 - 23159468
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||||| ||||||||||||||||||||    
T  23159510 ggtggtcggggtttgaaccccgaatcttgcatatattatgcat 23159468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 33105468 - 33105418
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| || ||| ||||||||||||||||| ||||||||||||||||||    
T  33105468 tttttggtggaggctggggtttgaaccccggaccttgcatatattatgcat 33105418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 44794970 - 44794920
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||| ||||||||| ||||| ||||||||||||||||||    
T  44794970 ttttttgcggtggccgaggtttgaactccggaccttgcatatattatgcat 44794920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 450 - 490
Target Start/End: Original strand, 13124357 - 13124397
Alignment:
Q  450 tggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||| ||||||||| ||||||||    
T  13124357 tggccggggtttgaaccccggaccttgcatattttatgcat 13124397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 443 - 490
Target Start/End: Complemental strand, 6471585 - 6471538
Alignment:
Q  443 ttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||||||||||||||||||||| |  |||||||||||||||||    
T  6471585 ttggtggtggccggggtttgaaccccgaacattgcatatattatgcat 6471538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Original strand, 42172242 - 42172277
Alignment:
Q  455 ggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||| ||||||||||||||||||||||||    
T  42172242 ggggtttgaactccggatcttgcatatattatgcat 42172277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 3650589 - 3650547
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||| | ||| ||||||||||||||    
T  3650589 ggtggccggggtttgaaccccgaaccttacatatattatgcat 3650547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 6235543 - 6235585
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||| |||||| ||| ||||||||||||||    
T  6235543 ggtggccggggtttgaatcccggaccttacatatattatgcat 6235585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 8717467 - 8717509
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| ||||||||||||| | ||||||||||||||||||    
T  8717467 ggtggccgaggtttgaaccccgaaccttgcatatattatgcat 8717509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 13357425 - 13357475
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||| |||||||||| || | ||||||||||||||||||    
T  13357425 tttttggtggtggccgaggtttgaacctcgtaccttgcatatattatgcat 13357475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 15001259 - 15001309
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||  ||| ||||||||| ||||||||    
T  15001259 tttttggtggtggccggggtttgaaccttggaccttgcatattttatgcat 15001309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 19163528 - 19163570
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||||||| |||||||| |||||||||    
T  19163528 ggtggtcggggtttgaaccccggaccttgcataaattatgcat 19163570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 20665355 - 20665397
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  20665355 ggtggccggggtttgaactccggaccttgcatattttatgcat 20665397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 30550718 - 30550760
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  30550718 ggtggccggggtttgaactccggaccttgcatattttatgcat 30550760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 37141426 - 37141384
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||| |||||||||||| | ||||||||||||||||||    
T  37141426 ggtggccggagtttgaaccccgaaccttgcatatattatgcat 37141384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 44215467 - 44215509
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  44215467 ggtggccggggtttgaactccggaccttgcatattttatgcat 44215509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 24023408 - 24023449
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||||||||||||||||| ||||||||| ||||||||    
T  24023408 gtggtcggggtttgaaccccggaccttgcatattttatgcat 24023449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 448 - 488
Target Start/End: Complemental strand, 7997009 - 7996969
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgc 488  Q
    ||||| ||||||||||||||| || ||||||||||||||||    
T  7997009 ggtggtcggggtttgaaccccagaccttgcatatattatgc 7996969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Original strand, 10871888 - 10871928
Alignment:
Q  450 tggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| ||||||||||||||| |||||||| |||||||||    
T  10871888 tggccgaggtttgaaccccggaccttgcatacattatgcat 10871928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 48)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 38130943 - 38130993
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||||||| ||||||||||||||||||    
T  38130943 tttttggtggtggccggggtttgaaccccggaccttgcatatattatgcat 38130993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 438 - 490
Target Start/End: Original strand, 48849745 - 48849797
Alignment:
Q  438 tctttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| | |||||||||||||||||||||||| ||||||||||||||||||    
T  48849745 tcttttttgtggtggccggggtttgaaccccggaccttgcatatattatgcat 48849797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 448 - 487
Target Start/End: Complemental strand, 11358303 - 11358264
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatg 487  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  11358303 ggtggccggggtttgaaccccggatcttgcatatattatg 11358264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 4601921 - 4601871
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||||||| ||||||| ||||||||||    
T  4601921 tttttggtggtggccggggtttgaaccccggaccttgcatttattatgcat 4601871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 25340908 - 25340958
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||||||| ||||||||| ||||||||    
T  25340908 tttttggtggtggccggggtttgaaccccggaccttgcatattttatgcat 25340958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 51882192 - 51882234
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||| ||||||||||||||||||||||    
T  51882192 ggtggccggggtttgaaccctggatcttgcatatattatgcat 51882234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 454 - 490
Target Start/End: Original strand, 10922306 - 10922342
Alignment:
Q  454 cggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||||||||||||||||||    
T  10922306 cggggtttgaaccccggatcttgcatatattatgcat 10922342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 334839 - 334881
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||||| ||||||||| ||||||||    
T  334839 ggtggccggggtttgaaccccggaccttgcatattttatgcat 334881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 913584 - 913634
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||| | ||||||||||||||| ||||||||||||||||||    
T  913584 tttttggtggtggcagaggtttgaaccccggaccttgcatatattatgcat 913634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 14827594 - 14827552
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||| ||||||||||||||||||| ||||||||    
T  14827594 ggtggccggggtttaaaccccggatcttgcatattttatgcat 14827552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 16792958 - 16793008
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||| ||||||||||||||| ||| ||||||||||||||||||    
T  16792958 tttttggtggtgaccggggtttgaaccctggaccttgcatatattatgcat 16793008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 25441492 - 25441534
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||||| || ||||||||||||||||||    
T  25441492 ggtggccggggtttgaaccccagaccttgcatatattatgcat 25441534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 29631263 - 29631213
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||||||||||||| |||| | ||||||||||||||||||    
T  29631263 tttttggtggtggccggggtttgaatcccgaaccttgcatatattatgcat 29631213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 34899166 - 34899124
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||||||| ||||||||||||||||||    
T  34899166 ggtggtcggggtttgaaccccggaccttgcatatattatgcat 34899124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 41817576 - 41817526
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||  |||||||||||||||| ||||||||||||||||||    
T  41817576 tttttggtggtggctagggtttgaaccccggaccttgcatatattatgcat 41817526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 45432017 - 45431975
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||| ||||||||||||||||||    
T  45432017 ggtggccagggtttgaaccccggaccttgcatatattatgcat 45431975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 441 - 490
Target Start/End: Original strand, 22251445 - 22251494
Alignment:
Q  441 ttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| ||||||||||||| |||||||||| | ||||||||||||||||    
T  22251445 ttttggtggtggccggggttcgaaccccggaccgtgcatatattatgcat 22251494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 438 - 490
Target Start/End: Original strand, 55066582 - 55066634
Alignment:
Q  438 tctttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||| |||||||||| |||||||||| || | ||||||||||||||||    
T  55066582 tctttttggtggtggccgggatttgaaccccagaccatgcatatattatgcat 55066634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 916508 - 916466
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  916508 ggtggccggggtttgaactccggaccttgcatattttatgcat 916466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 7464483 - 7464525
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||||||| ||| ||||||||||||||    
T  7464483 ggtggtcggggtttgaaccccggaccttacatatattatgcat 7464525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8075854 - 8075812
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||| | || ||||||||||||||||||    
T  8075854 ggtggccggggtttgaacctcagaccttgcatatattatgcat 8075812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 8113554 - 8113596
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||| || ||||| |||||||||||||||||||||||    
T  8113554 ggtggccgggattcgaaccgcggatcttgcatatattatgcat 8113596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8238633 - 8238591
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||| ||||||||||| || ||||||||||||||||||    
T  8238633 ggtggccggagtttgaaccccagaccttgcatatattatgcat 8238591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 10102868 - 10102826
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||| |||| |||||| ||||||||||    
T  10102868 ggtggccggggtttgaaccctggattttgcatgtattatgcat 10102826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 10213791 - 10213749
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||| |||| |||||| ||||||||||    
T  10213791 ggtggccggggtttgaaccctggattttgcatgtattatgcat 10213749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 456 - 490
Target Start/End: Original strand, 16663236 - 16663270
Alignment:
Q  456 gggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||| ||||||||||||||||||    
T  16663236 gggtttgaaccccggaccttgcatatattatgcat 16663270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 17262253 - 17262204
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||| |||||||||| | ||||||||| ||||||||    
T  17262253 tttttggcggtggccgggg-ttgaaccccgaaccttgcatattttatgcat 17262204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 20612261 - 20612311
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||  ||||||||||||||||||||  | ||||||||||||||||||    
T  20612261 tttttggtagtggccggggtttgaaccccaaaccttgcatatattatgcat 20612311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 25727959 - 25728001
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||| ||||||||||||| ||||||||||||||||||    
T  25727959 ggtggtcgggatttgaaccccggaccttgcatatattatgcat 25728001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 30050420 - 30050462
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||| ||||||||| || ||||||||||||||||||||    
T  30050420 ggtggccggagtttgaaccgcgaatcttgcatatattatgcat 30050462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 32843254 - 32843296
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||||| || ||||||||| ||||||||    
T  32843254 ggtggccggggtttgaaccccagaccttgcatattttatgcat 32843296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 35191801 - 35191851
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||| | |||||| ||||||| || ||||||||||||||||||    
T  35191801 tttttggcggtgtctggggttcgaaccccagaccttgcatatattatgcat 35191851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 38603035 - 38602985
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||  | | ||||||||||||||||||    
T  38603035 tttttggtggtggccggggtttgaaccatgaaccttgcatatattatgcat 38602985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 44075148 - 44075190
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  44075148 ggtggccggggtttgaactccggaccttgcatattttatgcat 44075190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 45334266 - 45334216
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||| |||| ||||||||||| | ||||||||||||||||||    
T  45334266 tttttggtggtggtcgggatttgaaccccgaaccttgcatatattatgcat 45334216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 48796210 - 48796252
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||| | ||||||||| ||||||||    
T  48796210 ggtggccggggtttgaaccccgaaccttgcatatcttatgcat 48796252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 52119445 - 52119403
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||| |||||||| | ||||||||||||||||||    
T  52119445 ggtggccggggttcgaaccccgaaccttgcatatattatgcat 52119403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 54243454 - 54243412
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| |||||||||||||||||||  |||||||||||||    
T  54243454 ggtggccgaggtttgaaccccggatcttaaatatattatgcat 54243412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 440 - 489
Target Start/End: Complemental strand, 552251 - 552202
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgca 489  Q
    ||||||| || || |||||||||||||| ||| |||||||||||||||||    
T  552251 tttttggtggaggtcggggtttgaaccctggaccttgcatatattatgca 552202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 34442440 - 34442481
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||||||| ||| ||||| ||||||||    
T  34442440 gtggccggggtttgaaccccggaccttacatattttatgcat 34442481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 453 - 490
Target Start/End: Original strand, 35126266 - 35126303
Alignment:
Q  453 ccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||| |||||||||||||||||||||    
T  35126266 ccgggatttgaaccccagatcttgcatatattatgcat 35126303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 443 - 488
Target Start/End: Original strand, 35210118 - 35210163
Alignment:
Q  443 ttggcggtggccggggtttgaaccccggatcttgcatatattatgc 488  Q
    |||| |||||||| ||||||||||||||| ||||||||| ||||||    
T  35210118 ttggtggtggccgaggtttgaaccccggaccttgcatattttatgc 35210163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 438 - 487
Target Start/End: Original strand, 35863795 - 35863844
Alignment:
Q  438 tctttttggcggtggccggggtttgaaccccggatcttgcatatattatg 487  Q
    ||||||| | |||||||| |||||||||||| || |||||||||||||||    
T  35863795 tcttttttgtggtggccgaggtttgaaccccagaccttgcatatattatg 35863844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 448 - 489
Target Start/End: Original strand, 45885469 - 45885510
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgca 489  Q
    ||||||||||||||||||| | || |||||||||||||||||    
T  45885469 ggtggccggggtttgaacctcagaccttgcatatattatgca 45885510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 48315017 - 48315058
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||| ||||||||||||| ||||||||||||||||||    
T  48315017 gtggtcgggatttgaaccccggaccttgcatatattatgcat 48315058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 457 - 490
Target Start/End: Original strand, 48656900 - 48656933
Alignment:
Q  457 ggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||| ||||||||||||||||||    
T  48656900 ggtttgaaccccggaccttgcatatattatgcat 48656933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 440 - 481
Target Start/End: Complemental strand, 53365981 - 53365940
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatat 481  Q
    ||||||| |||||||||| ||||||||||||| |||||||||    
T  53365981 tttttggtggtggccgggatttgaaccccggaccttgcatat 53365940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 458 - 490
Target Start/End: Original strand, 24120422 - 24120454
Alignment:
Q  458 gtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||| |||||||||||||||||||||||    
T  24120422 gtttgaaccgcggatcttgcatatattatgcat 24120454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 56)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 10735815 - 10735865
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||||||| ||||||||||||||||||    
T  10735815 tttttggtggtggccggggtttgaaccccggaccttgcatatattatgcat 10735865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 29544704 - 29544654
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||||||| ||||||||||||||||||    
T  29544704 tttttggtggtggccggggtttgaaccccggaccttgcatatattatgcat 29544654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 443 - 490
Target Start/End: Complemental strand, 27848232 - 27848185
Alignment:
Q  443 ttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||||||||||||||||||||||| ||||||||||||||||||    
T  27848232 ttggtggtggccggggtttgaaccccggaccttgcatatattatgcat 27848185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 24592830 - 24592880
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||||||||||||||||| || ||||||||||||||||||    
T  24592830 tttttggtggtggccggggtttgaaccccagaccttgcatatattatgcat 24592880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 42791372 - 42791322
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||  ||||||||||||||||||||||| ||||||||||||||||||    
T  42791372 tttttggtagtggccggggtttgaaccccggaccttgcatatattatgcat 42791322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 440 - 489
Target Start/End: Complemental strand, 27411169 - 27411120
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgca 489  Q
    ||||||| ||||||||||||| |||||||||| |||||||||||||||||    
T  27411169 tttttggtggtggccggggttcgaaccccggaccttgcatatattatgca 27411120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 440 - 487
Target Start/End: Complemental strand, 44810782 - 44810735
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatg 487  Q
    ||||||| |||||| ||||||||||||||||| |||||||||||||||    
T  44810782 tttttggtggtggctggggtttgaaccccggaccttgcatatattatg 44810735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 11175854 - 11175812
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||| ||||||||||| |||||||||||||||||||||    
T  11175854 ggtggccggagtttgaaccccagatcttgcatatattatgcat 11175812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 16390680 - 16390630
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||||||||| |||||||||| ||||||||| ||||||||    
T  16390680 tttttggtggtggccggggttcgaaccccggaccttgcatattttatgcat 16390630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 20200774 - 20200732
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||| ||| ||||||||||||||||||    
T  20200774 ggtggccggggtttgaaccctggaccttgcatatattatgcat 20200732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 25186234 - 25186276
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| ||||||||||||||||| ||||||||||||||||||    
T  25186234 ggtggctggggtttgaaccccggaccttgcatatattatgcat 25186276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 28771659 - 28771609
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||| |||||||| ||||| |||||||||||||||||||||||    
T  28771659 tttttggtggtgtccggggttcgaaccgcggatcttgcatatattatgcat 28771609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 31815879 - 31815921
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||||||| ||||||||||||||||||    
T  31815879 ggtggtcggggtttgaaccccggaccttgcatatattatgcat 31815921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 18693655 - 18693696
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||||||||||||| ||||||||||||||||||||||    
T  18693655 gtggtcggggtttgaaccctggatcttgcatatattatgcat 18693696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 22709153 - 22709112
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||||||| ||||||||| ||||||||    
T  22709153 gtggccggggtttgaaccccggaccttgcatattttatgcat 22709112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Original strand, 20565074 - 20565109
Alignment:
Q  455 ggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||| ||||||||||||||||||    
T  20565074 ggggtttgaaccccggaccttgcatatattatgcat 20565109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Complemental strand, 31543074 - 31543039
Alignment:
Q  455 ggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||| ||||||||||||||||||    
T  31543074 ggggtttgaaccccggaccttgcatatattatgcat 31543039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 660814 - 660856
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||| ||| ||||||||||||||||||    
T  660814 ggtggtcggggtttgaaccctggaccttgcatatattatgcat 660856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 2257040 - 2256998
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||| ||||||| || ||||||||||||||||||    
T  2257040 ggtggccggggttcgaaccccagaccttgcatatattatgcat 2256998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 3708762 - 3708720
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  3708762 ggtggccggggtttgaactccggaccttgcatattttatgcat 3708720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 4180774 - 4180724
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||  |||| |||||||||||||||||| ||||||||| ||||||||    
T  4180774 tttttggtagtggtcggggtttgaaccccggaccttgcatattttatgcat 4180724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 450 - 488
Target Start/End: Original strand, 4927443 - 4927481
Alignment:
Q  450 tggccggggtttgaaccccggatcttgcatatattatgc 488  Q
    |||||||||||||||||||||| ||| ||||||||||||    
T  4927443 tggccggggtttgaaccccggaccttacatatattatgc 4927481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 5168563 - 5168613
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||| | |||||||||||||||| | ||||||||||||||||||    
T  5168563 tttttggtggtagtcggggtttgaaccccgaaccttgcatatattatgcat 5168613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8728888 - 8728846
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||| ||||||||||||| ||||||||    
T  8728888 ggtggtcggggtttgaaccctggatcttgcatattttatgcat 8728846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 9516993 - 9517043
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||| |||| ||| ||||||||||| |||||||||||||    
T  9516993 tttttggtggtggccgaggttcgaaacccggatcttgtatatattatgcat 9517043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 10724008 - 10723966
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||| | || ||||||||||||||||||    
T  10724008 ggtggccggggtttgaacctcagaccttgcatatattatgcat 10723966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 11868654 - 11868696
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  11868654 ggtggccggggtttgaactccggaccttgcatattttatgcat 11868696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 11931674 - 11931632
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||| |||| | |||||||||||||||||||||||||    
T  11931674 ggtggccgggttttgtatcccggatcttgcatatattatgcat 11931632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 15447706 - 15447748
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| || || ||||||||||||||||||    
T  15447706 ggtggccggggtttgaactccagaccttgcatatattatgcat 15447748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 20455960 - 20455918
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||| || |||||||||| ||||||||||||||||||    
T  20455960 ggtggccgggattcgaaccccggaccttgcatatattatgcat 20455918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 23250312 - 23250354
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||| ||| ||||||||||||||||||    
T  23250312 ggtggtcggggtttgaaccctggaccttgcatatattatgcat 23250354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 30089118 - 30089076
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| ||||||||||||||| |||| |||||||||||||    
T  30089118 ggtggccgaggtttgaaccccggaccttgtatatattatgcat 30089076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 30125722 - 30125680
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| ||||||||||||||| |||| |||||||||||||    
T  30125722 ggtggccgaggtttgaaccccggaccttgtatatattatgcat 30125680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 30243327 - 30243277
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||| ||||||||||||| | |||| |||||||||||||    
T  30243327 tttttggtggtggccgaggtttgaaccccgaaccttgtatatattatgcat 30243277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 33064063 - 33064013
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||||| ||| |||| ||||| ||||||||||||||||||    
T  33064063 tttttggtggtggccggagttcgaactccggaccttgcatatattatgcat 33064013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 34977273 - 34977231
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||| ||| ||||| ||||||||||||||||||    
T  34977273 ggtggccggggtttaaactccggaccttgcatatattatgcat 34977231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 35360047 - 35360089
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  35360047 ggtggccggggtttgaactccggaccttgcatattttatgcat 35360089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 35820293 - 35820335
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| ||||||||||||||| ||||||| ||||||||||    
T  35820293 ggtggccgaggtttgaaccccggaccttgcatgtattatgcat 35820335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 36359383 - 36359341
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||  ||||||||||||||| ||||||||||||||||||    
T  36359383 ggtggccaaggtttgaaccccggaccttgcatatattatgcat 36359341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 36474839 - 36474789
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||  ||||||||||||| ||||||||| ||||||||    
T  36474839 tttttggtggtggccggaatttgaaccccggaccttgcatattttatgcat 36474789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 41778928 - 41778978
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||| || ||||| |||| ||||||||||||||||||    
T  41778928 tttttggtggtggccgggattcgaacctcggaccttgcatatattatgcat 41778978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 41859921 - 41859879
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||||| || ||||||||| ||||||||    
T  41859921 ggtggccggggtttgaaccccagaccttgcatattttatgcat 41859879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 44526197 - 44526155
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||| |||||| ||||| ||||||||||||    
T  44526197 ggtggccggggtttgaatcccggaccttgcgtatattatgcat 44526155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 8781643 - 8781684
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||||||||||||||||| |||||||| |||||||||    
T  8781643 gtggtcggggtttgaaccccggaccttgcatacattatgcat 8781684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 11551236 - 11551195
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| |||||||||||| ||||||||||| ||||||||    
T  11551236 gtggccggagtttgaaccccgaatcttgcatattttatgcat 11551195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 40853811 - 40853852
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||||||||| ||||||| ||||||||||||||||||    
T  40853811 gtggtcggggtttgatccccggaccttgcatatattatgcat 40853852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Complemental strand, 7206192 - 7206152
Alignment:
Q  450 tggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||| |||| |||| ||||||||||||||||||    
T  7206192 tggccggggtttaaacctcggaccttgcatatattatgcat 7206152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 458 - 490
Target Start/End: Original strand, 8091160 - 8091192
Alignment:
Q  458 gtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||| ||||||||||||||||||    
T  8091160 gtttgaaccccggaccttgcatatattatgcat 8091192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 440 - 488
Target Start/End: Complemental strand, 10811145 - 10811097
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgc 488  Q
    |||||||  ||||| ||||||||||||||||| ||||||||| ||||||    
T  10811145 tttttggtagtggctggggtttgaaccccggaccttgcatattttatgc 10811097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 29734754 - 29734718
Alignment:
Q  454 cggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||| |||| ||||||||||||||||||    
T  29734754 cggggtttgaaccacggaccttgcatatattatgcat 29734718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 442 - 490
Target Start/End: Original strand, 29896280 - 29896328
Alignment:
Q  442 tttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| ||||| |||||||||||||||  | ||||||||||||||||||    
T  29896280 tttggtggtggtcggggtttgaaccccaaaccttgcatatattatgcat 29896328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 442 - 490
Target Start/End: Complemental strand, 31477046 - 31476998
Alignment:
Q  442 tttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||| ||||||||||| | |||| |||||||||||||    
T  31477046 tttggtggtggccgggatttgaaccccgaaccttgtatatattatgcat 31476998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 446 - 490
Target Start/End: Complemental strand, 33567732 - 33567688
Alignment:
Q  446 gcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||| ||| ||||||||| | ||||||    
T  33567732 gcggtggccggggtttgaaccctggaacttgcatatttcatgcat 33567688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Original strand, 41763872 - 41763912
Alignment:
Q  450 tggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||| | |||||||| |||||||    
T  41763872 tggccggggtttgaaccccggaccgtgcatatactatgcat 41763912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 440 - 488
Target Start/End: Complemental strand, 42754122 - 42754074
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgc 488  Q
    ||||||| ||||||||||| | ||||| |||| ||||||||||||||||    
T  42754122 tttttggtggtggccggggatcgaacctcggaccttgcatatattatgc 42754074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Complemental strand, 44694755 - 44694715
Alignment:
Q  450 tggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||||   ||||||||||||||||||    
T  44694755 tggccggggtttgaaccccgagccttgcatatattatgcat 44694715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 39)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 14046603 - 14046645
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||| ||||||||||||||||||||    
T  14046603 ggtggccggggtttgaaccccgtatcttgcatatattatgcat 14046645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 14356633 - 14356675
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||| ||||||||||||||||||||    
T  14356633 ggtggccggggtttgaaccccgtatcttgcatatattatgcat 14356675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 19416591 - 19416541
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||||||| ||||||||| ||||||||    
T  19416591 tttttggtggtggccggggtttgaaccccggaccttgcatattttatgcat 19416541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 27462428 - 27462470
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||||| ||||||||||||||||||    
T  27462428 ggtggccggggtttgaaccccggaccttgcatatattatgcat 27462470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 8084504 - 8084454
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||||||||| |||||||||| ||||||||| ||||||||    
T  8084504 tttttggtggtggccggggttcgaaccccggaccttgcatattttatgcat 8084454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 18714525 - 18714475
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||  |||||||||||||||||| ||||||||||||||||||    
T  18714525 tttttggtggtgtacggggtttgaaccccggaccttgcatatattatgcat 18714475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 19599214 - 19599172
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||||||| ||||||||||||||||||    
T  19599214 ggtggtcggggtttgaaccccggaccttgcatatattatgcat 19599172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 21322252 - 21322202
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||| ||| |||||||| |||||||||    
T  21322252 tttttggtggtggccggggtttgaaccctggaccttgcatacattatgcat 21322202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 36121729 - 36121679
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||  ||||||||||||||||||||||| ||||||||| ||||||||    
T  36121729 tttttggtagtggccggggtttgaaccccggaccttgcatattttatgcat 36121679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 42829226 - 42829268
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||| |||||||||||||| ||||||||||||||||||    
T  42829226 ggtggccggagtttgaaccccggagcttgcatatattatgcat 42829268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 440 - 485
Target Start/End: Complemental strand, 145595 - 145550
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatatta 485  Q
    ||||||| ||||| |||||||||||||||||| |||||||||||||    
T  145595 tttttggtggtggtcggggtttgaaccccggaccttgcatatatta 145550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 19626518 - 19626559
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| |||||||||||||| ||||||||||||||||||    
T  19626518 gtggccggtgtttgaaccccggaccttgcatatattatgcat 19626559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 46737853 - 46737812
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| |||||||||||||| ||||||||||||||||||    
T  46737853 gtggccggtgtttgaaccccggaccttgcatatattatgcat 46737812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 441 - 488
Target Start/End: Complemental strand, 2512385 - 2512338
Alignment:
Q  441 ttttggcggtggccggggtttgaaccccggatcttgcatatattatgc 488  Q
    |||||| ||||||||||||||||||| || | ||||||||||||||||    
T  2512385 ttttggtggtggccggggtttgaacctcgtaccttgcatatattatgc 2512338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Original strand, 20085758 - 20085793
Alignment:
Q  455 ggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||| ||||||||||||||||||    
T  20085758 ggggtttgaaccccggaccttgcatatattatgcat 20085793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 3830137 - 3830095
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| ||||||||||||| ||| ||||||||||||||||||    
T  3830137 ggtggctggggtttgaaccctggaccttgcatatattatgcat 3830095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 456 - 490
Target Start/End: Complemental strand, 10244788 - 10244754
Alignment:
Q  456 gggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||| ||||||||||||||||||    
T  10244788 gggtttgaaccccggaccttgcatatattatgcat 10244754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 20763223 - 20763181
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  20763223 ggtggccggggtttgaactccggaccttgcatattttatgcat 20763181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 482
Target Start/End: Complemental strand, 21174436 - 21174394
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatata 482  Q
    ||||||| |||||||||||||||||||||||| ||| ||||||    
T  21174436 tttttggtggtggccggggtttgaaccccggaactttcatata 21174394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 27833393 - 27833435
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||||||| ||| ||||||||||||||    
T  27833393 ggtggtcggggtttgaaccccggaccttacatatattatgcat 27833435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 29488789 - 29488747
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  29488789 ggtggccggggtttgaactccggaccttgcatattttatgcat 29488747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 31038506 - 31038556
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||||||||||||||||| || |||||||| | |||||||    
T  31038506 tttttggtggtggccggggtttgaaccccagaccttgcatacaatatgcat 31038556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 33232389 - 33232431
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  33232389 ggtggccggggtttgaactccggaccttgcatattttatgcat 33232431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 33473505 - 33473555
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||| ||||| |||||| ||| ||||||||||||||||||    
T  33473505 tttttggtggtggccagggttggaaccctggaccttgcatatattatgcat 33473555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 34284531 - 34284573
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  34284531 ggtggccggggtttgaactccggaccttgcatattttatgcat 34284573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 39801783 - 39801733
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||  |||||| | |||||||||||||||||||||||||||    
T  39801783 tttttggtggtggttggggttcgtaccccggatcttgcatatattatgcat 39801733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 42095935 - 42095977
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| | ||||||||||||||| ||||||||||||||||||    
T  42095935 ggtggcagaggtttgaaccccggaccttgcatatattatgcat 42095977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 43346548 - 43346598
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||  ||||||||| ||||||||||| ||||||||||||||    
T  43346548 tttttggtggtggatggggtttgatccccggatcttacatatattatgcat 43346598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 46987155 - 46987113
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||||||| |||||||||| ||||||||||||||||||    
T  46987155 ggtgtccggggttcgaaccccggaccttgcatatattatgcat 46987113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 48629057 - 48629099
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||| ||||||||| ||||||||||||||||||    
T  48629057 ggtggtcggggtttaaaccccggaccttgcatatattatgcat 48629099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 448 - 489
Target Start/End: Complemental strand, 5579762 - 5579721
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgca 489  Q
    ||||| ||||||||||||||| || |||||||||||||||||    
T  5579762 ggtggtcggggtttgaaccccagaccttgcatatattatgca 5579721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 457 - 490
Target Start/End: Complemental strand, 7670494 - 7670461
Alignment:
Q  457 ggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||| ||||||||||||||||||    
T  7670494 ggtttgaaccccggaccttgcatatattatgcat 7670461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 10421990 - 10422031
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| ||||||||||| |||||| ||||||||||||||    
T  10421990 gtggccggagtttgaaccccagatcttacatatattatgcat 10422031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 453 - 486
Target Start/End: Complemental strand, 23147354 - 23147321
Alignment:
Q  453 ccggggtttgaaccccggatcttgcatatattat 486  Q
    ||||||||||||||||||| ||||||||||||||    
T  23147354 ccggggtttgaaccccggaccttgcatatattat 23147321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 448 - 489
Target Start/End: Original strand, 42753519 - 42753560
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgca 489  Q
    |||||| || |||||||||||||| |||||||||||||||||    
T  42753519 ggtggctggagtttgaaccccggaccttgcatatattatgca 42753560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 441 - 490
Target Start/End: Complemental strand, 46371057 - 46371008
Alignment:
Q  441 ttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| ||||| ||| |||||||||||||| |||| |||||||||||||    
T  46371057 ttttggtggtggtcggagtttgaaccccggaccttggatatattatgcat 46371008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 462 - 490
Target Start/End: Original strand, 1285075 - 1285103
Alignment:
Q  462 gaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||||||||||    
T  1285075 gaaccccggatcttgcatatattatgcat 1285103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 10242543 - 10242507
Alignment:
Q  454 cggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||| ||| ||||||||||||||||||    
T  10242543 cggggtttgaaccctggaccttgcatatattatgcat 10242507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 458 - 490
Target Start/End: Original strand, 39280820 - 39280852
Alignment:
Q  458 gtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||| ||||||||||||||||||    
T  39280820 gtttgaaccccggaccttgcatatattatgcat 39280852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 34)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8569778 - 8569736
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||||| ||||||||||||||||||    
T  8569778 ggtggccggggtttgaaccccggaccttgcatatattatgcat 8569736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 655733 - 655783
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||  |||||||||||| |||||||||| ||||||||||||||||||    
T  655733 tttttggtagtggccggggttcgaaccccggaccttgcatatattatgcat 655783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 7082976 - 7083026
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||| ||||||||||| || |||||||||||||||||||||    
T  7082976 tttttggtggtggctggggtttgaactccagatcttgcatatattatgcat 7083026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 27907935 - 27907985
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||||||||||||||||| || ||||||||| ||||||||    
T  27907935 tttttggtggtggccggggtttgaaccccagaccttgcatattttatgcat 27907985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 29740551 - 29740509
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||||| ||||| ||||||||||||    
T  29740551 ggtggccggggtttgaaccccggaccttgcgtatattatgcat 29740509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 33824950 - 33824908
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| ||||||||||||||| ||||||||||||||||||    
T  33824950 ggtggccgaggtttgaaccccggaccttgcatatattatgcat 33824908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 2655020 - 2655061
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||||||||||| ||||| ||||||||    
T  2655020 gtggccggggtttgaaccccggatcttacatattttatgcat 2655061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 8809369 - 8809333
Alignment:
Q  454 cggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||| |||||||||||||||||||||||    
T  8809369 cggggtttgaacctcggatcttgcatatattatgcat 8809333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 450 - 490
Target Start/End: Complemental strand, 33976311 - 33976271
Alignment:
Q  450 tggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||| ||||||||| ||||||||    
T  33976311 tggccggggtttgaaccccggaccttgcatattttatgcat 33976271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Complemental strand, 291429 - 291394
Alignment:
Q  455 ggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||| ||||||||||||||||||    
T  291429 ggggtttgaaccccggaccttgcatatattatgcat 291394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 440 - 487
Target Start/End: Complemental strand, 17151313 - 17151266
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatg 487  Q
    ||||||| |||||||| |||||||||||| || |||||||||||||||    
T  17151313 tttttggtggtggccgaggtttgaaccccagaccttgcatatattatg 17151266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 447 - 490
Target Start/End: Complemental strand, 28898926 - 28898883
Alignment:
Q  447 cggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||| ||||| ||| ||||||||||||||    
T  28898926 cggtggccggggtttgaactccggacctttcatatattatgcat 28898883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 247728 - 247686
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  247728 ggtggccggggtttgaactccggaccttgcatattttatgcat 247686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 441 - 487
Target Start/End: Complemental strand, 2546256 - 2546210
Alignment:
Q  441 ttttggcggtggccggggtttgaaccccggatcttgcatatattatg 487  Q
    |||||| ||||| |||||||||||||||| | |||||||||||||||    
T  2546256 ttttggtggtggtcggggtttgaaccccgtaccttgcatatattatg 2546210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 2726409 - 2726451
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||||||| |||||||||| ||||||||||||||||||    
T  2726409 ggtgaccggggttcgaaccccggaccttgcatatattatgcat 2726451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 12184577 - 12184535
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||| |||||||| |||| ||||||||||||||||||    
T  12184577 ggtggccgggatttgaaccacggaccttgcatatattatgcat 12184535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 13496193 - 13496143
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| | ||| |||||||||||| ||||| ||||||||||||||||||    
T  13496193 tttttggtgttggtcggggtttgaactccggaccttgcatatattatgcat 13496143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 15187132 - 15187090
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| ||||||||||||| |||| ||||||||||||||||||    
T  15187132 ggtggtcggggtttgaacctcggaccttgcatatattatgcat 15187090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 15473474 - 15473516
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| ||||||||||||| |||| ||||||||||||||||||    
T  15473474 ggtggtcggggtttgaacctcggaccttgcatatattatgcat 15473516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 16390498 - 16390456
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| ||||||||||||||| ||| ||||||||||||||    
T  16390498 ggtggccgaggtttgaaccccggaccttacatatattatgcat 16390456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 24373702 - 24373744
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| |||||||||||||| || ||||||||||||||||||    
T  24373702 ggtggctggggtttgaacccctgaccttgcatatattatgcat 24373744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 28231417 - 28231459
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||| || ||||||||||| ||||||||||||||||||    
T  28231417 ggtggccggagtgtgaaccccggaccttgcatatattatgcat 28231459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 34481398 - 34481448
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||  |||| |||||||||||||||||| ||||||||||| ||||||    
T  34481398 tttttggttgtggtcggggtttgaaccccggaccttgcatatataatgcat 34481448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 2692283 - 2692242
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| ||||||||| | |||||||||||||||||||||||    
T  2692283 gtggccagggtttgaatctcggatcttgcatatattatgcat 2692242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 441 - 490
Target Start/End: Complemental strand, 10018475 - 10018426
Alignment:
Q  441 ttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| ||||||||| |||||||||||| | ||| ||||||||||||||    
T  10018475 ttttggtggtggccggagtttgaaccccgaaccttacatatattatgcat 10018426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 20744206 - 20744165
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| ||||||||||||||| || ||||||||||||||||||    
T  20744206 gtggtcggggtttgaaccccagaccttgcatatattatgcat 20744165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 26356074 - 26356115
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| |||||||||||| | ||||||||||||||||||    
T  26356074 gtggccggagtttgaaccccgaaccttgcatatattatgcat 26356115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 441 - 486
Target Start/End: Complemental strand, 26548327 - 26548282
Alignment:
Q  441 ttttggcggtggccggggtttgaaccccggatcttgcatatattat 486  Q
    |||||| |||||| ||||||||||||||| | ||||||||||||||    
T  26548327 ttttggtggtggctggggtttgaaccccgaaccttgcatatattat 26548282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 442 - 490
Target Start/End: Complemental strand, 2445374 - 2445326
Alignment:
Q  442 tttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| ||||| ||||||| |||||||| |||||| |||||||||||||    
T  2445374 tttggtggtggtcggggttcgaaccccgaatcttgtatatattatgcat 2445326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 448 - 488
Target Start/End: Original strand, 4455588 - 4455628
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgc 488  Q
    ||||| ||||||||||||||| || ||||||||||||||||    
T  4455588 ggtggtcggggtttgaaccccagaccttgcatatattatgc 4455628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 9111110 - 9111074
Alignment:
Q  454 cggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||| ||||||||||||||||||    
T  9111110 cggggttcgaaccccggaccttgcatatattatgcat 9111074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 440 - 488
Target Start/End: Original strand, 9372340 - 9372387
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgc 488  Q
    ||||||| || |||||||||||||||||| || ||||||||||||||||    
T  9372340 tttttggtgggggccggggtttgaacccc-gaacttgcatatattatgc 9372387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Complemental strand, 12215820 - 12215780
Alignment:
Q  450 tggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| | ||||||||||||| ||||||||||||||||||    
T  12215820 tggccgtgatttgaaccccggaccttgcatatattatgcat 12215780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 438 - 486
Target Start/End: Original strand, 27928088 - 27928136
Alignment:
Q  438 tctttttggcggtggccggggtttgaaccccggatcttgcatatattat 486  Q
    ||||||| |||||||| | |||||||| |||||| ||||||||||||||    
T  27928088 tcttttttgcggtggctgaggtttgaatcccggaccttgcatatattat 27928136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 62)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 49041973 - 49042015
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||||| ||||||||||||||||||    
T  49041973 ggtggccggggtttgaaccccggaccttgcatatattatgcat 49042015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 54857599 - 54857649
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||||||| ||||||||| ||||||||    
T  54857599 tttttggtggtggccggggtttgaaccccggaccttgcatattttatgcat 54857649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 448 - 488
Target Start/End: Complemental strand, 11198397 - 11198357
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgc 488  Q
    |||||||||||||||||||||||| ||||||||||||||||    
T  11198397 ggtggccggggtttgaaccccggaccttgcatatattatgc 11198357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 438 - 490
Target Start/End: Original strand, 49385288 - 49385340
Alignment:
Q  438 tctttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||| |||||||| ||||||||| ||||||||| ||||||||||||||    
T  49385288 tctttttggtggtggccgaggtttgaactccggatcttacatatattatgcat 49385340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 435 - 490
Target Start/End: Complemental strand, 42139926 - 42139871
Alignment:
Q  435 tactctttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| ||||| ||||||||||||||||||||||||||  |||||| ||||||||||    
T  42139926 tacttttttttgcggtggccggggtttgaaccccggacattgcatgtattatgcat 42139871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 3936696 - 3936654
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||| |||||||||| ||||||||||||||||||    
T  3936696 ggtggccggggttcgaaccccggaccttgcatatattatgcat 3936654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 7230349 - 7230307
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| ||||||||||||||| ||||||||||||||||||    
T  7230349 ggtggccgaggtttgaaccccggaccttgcatatattatgcat 7230307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 8027389 - 8027431
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| ||||||||||||||| |||||||||||||||||||||    
T  8027389 ggtggtcggggtttgaacccccgatcttgcatatattatgcat 8027431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 9946504 - 9946454
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||| |||||||||||||||||| ||||||||| ||||||||    
T  9946504 tttttggtggtggtcggggtttgaaccccggaccttgcatattttatgcat 9946454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 11949755 - 11949797
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||||||| ||||||||||||||||||    
T  11949755 ggtggtcggggtttgaaccccggaccttgcatatattatgcat 11949797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 19479469 - 19479511
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||||||| ||||||||||||||||||    
T  19479469 ggtggtcggggtttgaaccccggaccttgcatatattatgcat 19479511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 20799378 - 20799428
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||| || |||||||||||||||| ||||||||||||||||||    
T  20799378 tttttggtggtgaccagggtttgaaccccggaccttgcatatattatgcat 20799428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 28435232 - 28435282
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||| ||||||||||||||| | ||||||||||||||||||    
T  28435232 tttttggtggtggctggggtttgaaccccgaaccttgcatatattatgcat 28435282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 43034326 - 43034376
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||||||||||||||||| | || ||||||||||||||||||    
T  43034326 tttttggtggtggccggggtttgaacctcagaccttgcatatattatgcat 43034376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 449 - 487
Target Start/End: Original strand, 47814244 - 47814282
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatg 487  Q
    ||||||||||||||||||||||| |||||||||||||||    
T  47814244 gtggccggggtttgaaccccggaccttgcatatattatg 47814282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 54294414 - 54294456
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| ||||||||||||||||||| ||||||||||||||||||    
T  54294414 ggtgtccggggtttgaaccccggaccttgcatatattatgcat 54294456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 56551584 - 56551626
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||| |||| ||||||||||||||||||    
T  56551584 ggtggccggggtttgaacctcggaccttgcatatattatgcat 56551626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 440 - 488
Target Start/End: Original strand, 23304000 - 23304048
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgc 488  Q
    ||||||| ||||||||||||| | |||||||| ||||||||||||||||    
T  23304000 tttttggtggtggccggggttcgcaccccggaccttgcatatattatgc 23304048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 44816004 - 44815968
Alignment:
Q  454 cggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||||||||||||||||    
T  44816004 cggggtttgaaccccggaccttgcatatattatgcat 44815968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 442 - 490
Target Start/End: Original strand, 49952657 - 49952705
Alignment:
Q  442 tttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||| |||||||| | || ||||||||||||||||||    
T  49952657 tttggcggtggccgggatttgaaccactgaccttgcatatattatgcat 49952705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Complemental strand, 675980 - 675945
Alignment:
Q  455 ggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||| ||||||||||||||||||    
T  675980 ggggtttgaaccccggaccttgcatatattatgcat 675945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 448 - 487
Target Start/End: Complemental strand, 10035334 - 10035295
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatg 487  Q
    ||||||||||||||||||||| || |||||||||||||||    
T  10035334 ggtggccggggtttgaaccccagaccttgcatatattatg 10035295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 455 - 490
Target Start/End: Complemental strand, 20383550 - 20383515
Alignment:
Q  455 ggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||| ||||||||||||||||||    
T  20383550 ggggtttgaaccccggaccttgcatatattatgcat 20383515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 432 - 487
Target Start/End: Complemental strand, 33495650 - 33495595
Alignment:
Q  432 atatactctttttggcggtggccggggtttgaaccccggatcttgcatatattatg 487  Q
    |||| |||||||||| |||||  ||||||||||||| | |||||||||||||||||    
T  33495650 atatcctctttttggtggtggttggggtttgaaccctgaatcttgcatatattatg 33495595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 451 - 490
Target Start/End: Original strand, 50152233 - 50152272
Alignment:
Q  451 ggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||| | ||||||||||||||||||    
T  50152233 ggccggggtttgaaccccgaaccttgcatatattatgcat 50152272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 486
Target Start/End: Complemental strand, 2888943 - 2888905
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattat 486  Q
    ||||||||||||||||||| |||| ||||||||||||||    
T  2888943 ggtggccggggtttgaaccgcggaccttgcatatattat 2888905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 6087816 - 6087774
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| |||||||||||||| || ||||||||||||||||||    
T  6087816 ggtggctggggtttgaaccccagaccttgcatatattatgcat 6087774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8495056 - 8495014
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||| ||||||| | ||||||||||||||||||||||    
T  8495056 ggtggccgggatttgaactcgggatcttgcatatattatgcat 8495014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 10261761 - 10261803
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  10261761 ggtggccggggtttgaactccggaccttgcatattttatgcat 10261803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 10303495 - 10303545
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||  ||||||| |||| |||||||||||||||||||| ||||||||    
T  10303495 tttttggtagtggccgaggttcgaaccccggatcttgcatattttatgcat 10303545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 12322742 - 12322700
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| | ||||||||||||||| ||||||||||||||||||    
T  12322742 ggtggctgaggtttgaaccccggaacttgcatatattatgcat 12322700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 16304090 - 16304132
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| |||||||| |||||| ||||||||||||||||||    
T  16304090 ggtggccgcggtttgaatcccggaccttgcatatattatgcat 16304132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 17423169 - 17423211
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| || |||||||||||||| ||||||||||||||||||    
T  17423169 ggtggctggagtttgaaccccggaccttgcatatattatgcat 17423211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 19588223 - 19588181
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||| ||| ||||||||| ||||||||    
T  19588223 ggtggccggggtttgaaccctggaccttgcatattttatgcat 19588181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 19854634 - 19854592
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| ||| |||| |||||||||||||||||||||||||||||    
T  19854634 ggtgtccgaggttcgaaccccggatcttgcatatattatgcat 19854592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 21114297 - 21114339
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||||||| ||||||||||| ||||||    
T  21114297 ggtggtcggggtttgaaccccggaccttgcatatatcatgcat 21114339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 21562694 - 21562652
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  21562694 ggtggccggggtttgaactccggaccttgcatattttatgcat 21562652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 24664983 - 24665025
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| ||||||| |||||||||| ||||||||||||||||||    
T  24664983 ggtggtcggggttcgaaccccggaccttgcatatattatgcat 24665025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 26926702 - 26926744
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  26926702 ggtggccggggtttgaactccggaccttgcatattttatgcat 26926744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 486
Target Start/End: Complemental strand, 29701157 - 29701119
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattat 486  Q
    ||||||||| |||||||||||||| ||||||||||||||    
T  29701157 ggtggccggagtttgaaccccggaacttgcatatattat 29701119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 35287499 - 35287541
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||| |||||||||| ||||||||| ||||||||    
T  35287499 ggtggccggggttggaaccccggaccttgcatattttatgcat 35287541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 36490637 - 36490595
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||| |||||||||||||||||||||| |||||||||    
T  36490637 ggtggtcgggatttgaaccccggatcttgcatacattatgcat 36490595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 452 - 490
Target Start/End: Complemental strand, 37921811 - 37921773
Alignment:
Q  452 gccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||| |||||| ||||||||||||||||||    
T  37921811 gccggggtttgaatcccggaccttgcatatattatgcat 37921773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 38375026 - 38374984
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| || || ||||||||||||||||||    
T  38375026 ggtggccggggtttgaactccagaccttgcatatattatgcat 38374984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 38453342 - 38453292
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||| |||||| |||||| ||| ||||||||||||||||||    
T  38453342 tttttggtggtggctggggttcgaaccctggaccttgcatatattatgcat 38453292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 43330215 - 43330173
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  43330215 ggtggccggggtttgaactccggaccttgcatattttatgcat 43330173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 44732577 - 44732527
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||| | |||||||||||||| ||||||||||| ||||||||    
T  44732577 tttttggtggtggtcagggtttgaaccccgtatcttgcatattttatgcat 44732527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 51450281 - 51450239
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||    
T  51450281 ggtggccggggtttgaactccggaccttgcatatcttatgcat 51450239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 56497592 - 56497642
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||| || ||||||| || ||||||||||||||||||    
T  56497592 tttttggtggtggccgggattcgaaccccagaccttgcatatattatgcat 56497642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 457 - 490
Target Start/End: Original strand, 14197432 - 14197465
Alignment:
Q  457 ggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||| ||||||||||||||    
T  14197432 ggtttgaaccccggatcttacatatattatgcat 14197465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 14202472 - 14202513
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||||||||||||||||| ||| ||||||||||||||    
T  14202472 gtggtcggggtttgaaccccggaccttacatatattatgcat 14202513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 448 - 489
Target Start/End: Complemental strand, 17729495 - 17729454
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgca 489  Q
    ||||| ||||||||||||||| || |||||||||||||||||    
T  17729495 ggtggtcggggtttgaaccccagaccttgcatatattatgca 17729454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 453 - 490
Target Start/End: Original strand, 25783446 - 25783483
Alignment:
Q  453 ccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||||||||||||| ||||||||||||||||||    
T  25783446 ccggagtttgaaccccggaccttgcatatattatgcat 25783483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 453 - 490
Target Start/End: Complemental strand, 28568269 - 28568232
Alignment:
Q  453 ccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||| |||||| |||||||||||||    
T  28568269 ccggggtttgaaccccgaatcttgtatatattatgcat 28568232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 441 - 490
Target Start/End: Complemental strand, 34042316 - 34042267
Alignment:
Q  441 ttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| ||||| || ||||||||||||| | ||||||||||||||||||    
T  34042316 ttttggtggtggtcgaggtttgaaccccgaaccttgcatatattatgcat 34042267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 48226760 - 48226719
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| |||||||||||||| ||||||||| ||||||||    
T  48226760 gtggccggagtttgaaccccggaccttgcatattttatgcat 48226719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Original strand, 14577501 - 14577541
Alignment:
Q  450 tggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||| |||||  |||||||||||||||||    
T  14577501 tggccggggtttgaactccggactttgcatatattatgcat 14577541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Complemental strand, 23154661 - 23154621
Alignment:
Q  450 tggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||| ||| ||||||||||| ||||||||    
T  23154661 tggccggggtttgaactccgaatcttgcatattttatgcat 23154621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 448 - 488
Target Start/End: Original strand, 23247590 - 23247630
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgc 488  Q
    |||||||||||||| |||||| || ||||||||||||||||    
T  23247590 ggtggccggggtttaaaccccagaccttgcatatattatgc 23247630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 448 - 488
Target Start/End: Complemental strand, 23810018 - 23809978
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgc 488  Q
    |||||||||||||||||||| | | ||||||||||||||||    
T  23810018 ggtggccggggtttgaaccctgaaccttgcatatattatgc 23809978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 43155142 - 43155106
Alignment:
Q  454 cggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||| | |||||||||||||||||||||    
T  43155142 cggggtttgaacctcagatcttgcatatattatgcat 43155106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 458 - 490
Target Start/End: Original strand, 49953405 - 49953437
Alignment:
Q  458 gtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||| ||||||||||||||||||    
T  49953405 gtttgaaccccggaccttgcatatattatgcat 49953437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 44)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 34521174 - 34521224
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||| ||||||||||||||| ||||||||||||||||||    
T  34521174 tttttggtggtggccgaggtttgaaccccggaccttgcatatattatgcat 34521224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 438 - 490
Target Start/End: Complemental strand, 27533322 - 27533270
Alignment:
Q  438 tctttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||| ||||| |||||||||||||||| | ||||||||||||||||||    
T  27533322 tctttttggtggtggtcggggtttgaaccccgaaccttgcatatattatgcat 27533270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 1794665 - 1794623
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| || ||||||||||||||||||||||||||||||||||    
T  1794665 ggtggtcgaggtttgaaccccggatcttgcatatattatgcat 1794623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 3481630 - 3481588
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||||| || ||||||||||||||||||    
T  3481630 ggtggccggggtttgaaccccagaccttgcatatattatgcat 3481588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 5907876 - 5907826
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||| ||||||||||||||| ||| ||||||||||||||||||    
T  5907876 tttttggtggtgtccggggtttgaaccctggaccttgcatatattatgcat 5907826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8736504 - 8736462
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||||| ||||||||| ||||||||    
T  8736504 ggtggccggggtttgaaccccggaccttgcatattttatgcat 8736462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 12212372 - 12212322
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||||||| ||||||||||||||||||  |||||||||||||||||    
T  12212372 ttttcggcggtggtcggggtttgaaccccggacgttgcatatattatgcat 12212322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 17139501 - 17139551
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||| |||||||||||||||||| |||| |||||||||||||    
T  17139501 tttttggtggtggtcggggtttgaaccccggaccttgaatatattatgcat 17139551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 452 - 490
Target Start/End: Complemental strand, 25533038 - 25533000
Alignment:
Q  452 gccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||| ||||||||||||||||||    
T  25533038 gccggggtttgaaccccggaccttgcatatattatgcat 25533000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 34595941 - 34595899
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| ||||||||||||||| ||||||||||||||||||    
T  34595941 ggtggccgaggtttgaaccccggaccttgcatatattatgcat 34595899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 41973324 - 41973282
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||| |||||||||| ||||||||||||||||||    
T  41973324 ggtggccggggttcgaaccccggaccttgcatatattatgcat 41973282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 42045356 - 42045406
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||| || || ||||||||||||||||||    
T  42045356 tttttggtggtggccggggtttgaactccagaccttgcatatattatgcat 42045406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 49431985 - 49432027
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||||||||||| ||| ||||||||||||||    
T  49431985 ggtggccggggtttgaaccccggaccttacatatattatgcat 49432027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 12268977 - 12269018
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||||||||||||||||| ||||||||||||||||||    
T  12268977 gtggtcggggtttgaaccccggaccttgcatatattatgcat 12269018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 17537755 - 17537714
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||| |||||||||| |||||||||||||    
T  17537755 gtggccggggtttgaacaccggatcttgtatatattatgcat 17537714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 448 - 485
Target Start/End: Original strand, 19795108 - 19795145
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatatta 485  Q
    |||||||||||||||||||||||| |||||||||||||    
T  19795108 ggtggccggggtttgaaccccggaccttgcatatatta 19795145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 449 - 490
Target Start/End: Original strand, 41763148 - 41763189
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||||||||||||||||| ||||||||| ||||||||    
T  41763148 gtggccggggtttgaaccccggaccttgcatattttatgcat 41763189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 448 - 483
Target Start/End: Original strand, 6423753 - 6423788
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatat 483  Q
    |||||||||||||||||||||||| |||||||||||    
T  6423753 ggtggccggggtttgaaccccggaccttgcatatat 6423788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 448 - 487
Target Start/End: Original strand, 8269360 - 8269399
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatg 487  Q
    ||||| |||||||||||||||||| |||||||||||||||    
T  8269360 ggtggtcggggtttgaaccccggaccttgcatatattatg 8269399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 5869833 - 5869791
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||| ||| ||||||||||||||||||||    
T  5869833 ggtggtcggggtttgaactccgaatcttgcatatattatgcat 5869791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 6000135 - 6000177
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| |||||||||||||| |||| ||||||||||||||||||    
T  6000135 ggtgtccggggtttgaacctcggaccttgcatatattatgcat 6000177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 8094110 - 8094068
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||| ||||||| | ||||||||||||||||||    
T  8094110 ggtggccggggtttaaaccccgcaccttgcatatattatgcat 8094068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 15854080 - 15854122
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||| |||||||| || ||||||||||||||||||||||    
T  15854080 ggtggccgaggtttgaatcctggatcttgcatatattatgcat 15854122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 16033442 - 16033484
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||| ||||||||||| || ||||||||||||||||||    
T  16033442 ggtggccggagtttgaaccccagaccttgcatatattatgcat 16033484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 18166679 - 18166629
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||  |||| ||||||||||||||||||  |||||||||||||||||    
T  18166679 tttttggtagtggtcggggtttgaaccccggactttgcatatattatgcat 18166629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 21638190 - 21638140
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||| |||||||| |||||||||| ||||||||||| ||||||    
T  21638190 tttttggtggtgtccggggttcgaaccccggaccttgcatatatcatgcat 21638140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 456 - 490
Target Start/End: Original strand, 26256089 - 26256123
Alignment:
Q  456 gggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||||||||||||||||||||||||||||    
T  26256089 gggttcgaaccccggatcttgcatatattatgcat 26256123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 29042606 - 29042564
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||| ||||||||||||||||| ||||||||||||||    
T  29042606 ggtggtcgggatttgaaccccggatcttacatatattatgcat 29042564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 29739414 - 29739364
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||| |||| ||||||||||||||| ||||||||| ||||||||    
T  29739414 tttttggtggtagccgaggtttgaaccccggaccttgcatattttatgcat 29739364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 32950745 - 32950795
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||| || ||||||||| ||||| ||||||||||||||||||    
T  32950745 tttttggtggtggtcgaggtttgaactccggaccttgcatatattatgcat 32950795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 486
Target Start/End: Complemental strand, 34632238 - 34632200
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattat 486  Q
    |||||||||| |||||||| |||||||||||||||||||    
T  34632238 ggtggccgggatttgaacctcggatcttgcatatattat 34632200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 486
Target Start/End: Original strand, 37810511 - 37810557
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattat 486  Q
    ||||||| ||||||| |||||||||||||| | ||||||||||||||    
T  37810511 tttttggtggtggccagggtttgaaccccgtaccttgcatatattat 37810557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 46707941 - 46707899
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||  |||||||||||||| ||||||||||||||||||    
T  46707941 ggtggccgatgtttgaaccccggaacttgcatatattatgcat 46707899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 486
Target Start/End: Complemental strand, 2994826 - 2994789
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattat 486  Q
    |||| |||||||||||||||||| ||||||||||||||    
T  2994826 gtggtcggggtttgaaccccggaccttgcatatattat 2994789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 453 - 490
Target Start/End: Complemental strand, 11681287 - 11681250
Alignment:
Q  453 ccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||| || ||||||||||||||||||    
T  11681287 ccggggtttgaaccccagaccttgcatatattatgcat 11681250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 449 - 490
Target Start/End: Complemental strand, 15668566 - 15668525
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| ||||||||||||||||| ||||||||| ||||||||    
T  15668566 gtggctggggtttgaaccccggaccttgcatattttatgcat 15668525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 487
Target Start/End: Original strand, 3937521 - 3937553
Alignment:
Q  455 ggggtttgaaccccggatcttgcatatattatg 487  Q
    ||||||||||||||||| |||||||||||||||    
T  3937521 ggggtttgaaccccggaccttgcatatattatg 3937553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 4302515 - 4302479
Alignment:
Q  454 cggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| ||||||| ||||||||||||||||||||||||    
T  4302515 cgggatttgaactccggatcttgcatatattatgcat 4302479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 440 - 484
Target Start/End: Original strand, 23730363 - 23730407
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatatt 484  Q
    ||||||| |||| |||||||| |||||||||| ||||||||||||    
T  23730363 tttttggtggtgtccggggttcgaaccccggaccttgcatatatt 23730407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 448 - 480
Target Start/End: Original strand, 24740832 - 24740864
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcata 480  Q
    |||||| ||||||||||||||||||||||||||    
T  24740832 ggtggctggggtttgaaccccggatcttgcata 24740864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Complemental strand, 26755683 - 26755643
Alignment:
Q  450 tggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||| ||||||||||||||| ||||||||||| ||||||    
T  26755683 tggccgaggtttgaaccccggaccttgcatatataatgcat 26755643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 487
Target Start/End: Original strand, 28016189 - 28016221
Alignment:
Q  455 ggggtttgaaccccggatcttgcatatattatg 487  Q
    ||||||||||||||||||||||||||| |||||    
T  28016189 ggggtttgaaccccggatcttgcatattttatg 28016221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 442 - 490
Target Start/End: Original strand, 38448852 - 38448900
Alignment:
Q  442 tttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||| |||| ||||| || |||||||||| ||||||||||||||||||    
T  38448852 tttggtggtgtccgggattcgaaccccggaccttgcatatattatgcat 38448900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 449 - 481
Target Start/End: Complemental strand, 52086177 - 52086145
Alignment:
Q  449 gtggccggggtttgaaccccggatcttgcatat 481  Q
    |||| ||||||||||||||||||||||||||||    
T  52086177 gtggtcggggtttgaaccccggatcttgcatat 52086145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 185332 - 185290
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| ||||||||||||||||||||||||||||| ||||||||    
T  185332 ggtgaccggggtttgaaccccggatcttgcatattttatgcat 185290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1127 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold1127
Description:

Target: scaffold1127; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 450 - 490
Target Start/End: Original strand, 1159 - 1199
Alignment:
Q  450 tggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||| ||||||||||||||||| ||||||||||||||||||    
T  1159 tggctggggtttgaaccccggaccttgcatatattatgcat 1199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0983 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0983
Description:

Target: scaffold0983; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 440 - 487
Target Start/End: Original strand, 3299 - 3346
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatg 487  Q
    |||||||| ||||||| ||||||||||||| | |||||||||||||||    
T  3299 tttttggcagtggccgaggtttgaaccccgaaccttgcatatattatg 3346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Original strand, 31914 - 31956
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||||| || ||||||||||| ||||||||||||||||||    
T  31914 ggtggccggagtgtgaaccccggaccttgcatatattatgcat 31956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0027 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0027
Description:

Target: scaffold0027; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Original strand, 61554 - 61604
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| |||||||||||||||||||| ||| ||| |||| |||||||||    
T  61554 tttttggtggtggccggggtttgaaccctggaccttacatacattatgcat 61604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0026
Description:

Target: scaffold0026; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 448 - 490
Target Start/End: Complemental strand, 75394 - 75352
Alignment:
Q  448 ggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||| || |||||||||| ||||||||||||||||||    
T  75394 ggtggccgggattcgaaccccggaccttgcatatattatgcat 75352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 440 - 490
Target Start/End: Complemental strand, 161218 - 161168
Alignment:
Q  440 tttttggcggtggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    ||||||| ||||| |||||||||||||||| | ||||||||| ||||||||    
T  161218 tttttggtggtggtcggggtttgaaccccgaaccttgcatattttatgcat 161168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 490
Target Start/End: Complemental strand, 239874 - 239834
Alignment:
Q  450 tggccggggtttgaaccccggatcttgcatatattatgcat 490  Q
    |||||||||||||||| |||||  |||||||||||||||||    
T  239874 tggccggggtttgaactccggactttgcatatattatgcat 239834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University