View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21222_high_14 (Length: 290)
Name: NF21222_high_14
Description: NF21222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21222_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 24 - 228
Target Start/End: Original strand, 44397199 - 44397403
Alignment:
| Q |
24 |
tatgtcggtttctgatgttatgtctcttcaaaatgatcatggtgaaacaccactttacatagctgcacacaataatctgaaggaagttttcacctttttg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44397199 |
tatgtcggtttctgatgttatgtctcttcaaaatgatcatggtgaaacaccactttacatagctgcacacaataatctgaaggaagttttcacctttttg |
44397298 |
T |
 |
| Q |
124 |
attaaattatgtgactttgaggttctcaagattcgttctaagtctgatatgaacgcttttcatgttgcagctaagcgtggccatcttggtattctactta |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44397299 |
attaaattatgtgactttgaggttctcaagattcgttctaagtctgatatgaacgcttttcatgttgcagctaagcgtggccatcttggtattctactta |
44397398 |
T |
 |
| Q |
224 |
ttcac |
228 |
Q |
| |
|
||||| |
|
|
| T |
44397399 |
ttcac |
44397403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 290
Target Start/End: Original strand, 44397421 - 44397466
Alignment:
| Q |
246 |
gtgttggttttgtt-aatactaagaacctgtgtttggatatttcta |
290 |
Q |
| |
|
||||||||||| || |||||||||||||| |||||||||||||||| |
|
|
| T |
44397421 |
gtgttggttttttttaatactaagaacctttgtttggatatttcta |
44397466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 11357935 - 11357982
Alignment:
| Q |
160 |
tctaagtctgatatgaacgcttttcatgttgcagctaagcgtggccat |
207 |
Q |
| |
|
||||| ||||||||||| || ||||| ||||||||||||||||||||| |
|
|
| T |
11357935 |
tctaaatctgatatgaatgcatttcacgttgcagctaagcgtggccat |
11357982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University