View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21222_high_17 (Length: 249)
Name: NF21222_high_17
Description: NF21222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21222_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 29 - 233
Target Start/End: Complemental strand, 25889725 - 25889512
Alignment:
| Q |
29 |
caagtttcttagcaattagttgcacatttatgagaaaaatcaaacttaattcaaaatattagtagaaacgttactttcaattaagatggatttttgtctt |
128 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||| |||||||| ||||| ||| |||||||||||||||||||||||||| | || |
|
|
| T |
25889725 |
caagtttcttaacaattagttgcacatttatgagaaaaatcaaatttaactcaaaatactagtaaaaatgttactttcaattaagatggatttttttttt |
25889626 |
T |
|
| Q |
129 |
ag---------ctctacctctacctttcacatctccacacaagttgtacatacacagttagaactaaattgtttaaatagtgcttctagtgttttgagtt |
219 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
25889625 |
tgtagctctacctctacctctacctttcacatctccacacaagttgtacatacacagttagaactaaattctttaaattgtgcttctagtgttttgagtt |
25889526 |
T |
|
| Q |
220 |
ggtgaggtagtttt |
233 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
25889525 |
ggtgaggttgtttt |
25889512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University