View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21222_high_3 (Length: 502)
Name: NF21222_high_3
Description: NF21222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21222_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 461; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 461; E-Value: 0
Query Start/End: Original strand, 18 - 486
Target Start/End: Original strand, 40866692 - 40867160
Alignment:
| Q |
18 |
ttattatcaggtccaccaacaagggcaccgatgagaatattagggttaggcttaggactttcataccaattatcatagccttgagtgcacccaataaaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866692 |
ttattatcaggtccaccaacaagggcaccgatgagaatattagggttaggcttaggactttcataccaattatcatagccttgagtgcacccaataaaac |
40866791 |
T |
 |
| Q |
118 |
ccatgttccctttgtatgattcagtggatgcacccctatggtgcaccctttgaggaaaatttgaaccataaccaaccaaatagctcatacccattggatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40866792 |
ccatgttccctttgtatgattcagtggatgcacccctatggtgcaccctttgaggaaaatttgaaccataaccaaccagatagctcatacccattggatt |
40866891 |
T |
 |
| Q |
218 |
agaacccaagatgtaatcaacttgtgattttgcaaaggctaagagttcattgggacccacctcacctttttggcaatgcaatttttgatttgtagctaag |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866892 |
agaacccaagatgtaatcaacttgtgattttgcaaaggctaagagttcattgggacccacctcacctttttggcaatgcaatttttgatttgtagctaag |
40866991 |
T |
 |
| Q |
318 |
aggtgatcagaataaatggcgagaagaaatgctgcatttgcaacatattgcatattgttccattggcggatgtatagtaaacctcctggggtgcgatcca |
417 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866992 |
aggtgatcagaataaatggccagaagaaatgctgcatttgcaacatattgcatattgttccattggcggatgtatagtaaacctcctggggtgcgatcca |
40867091 |
T |
 |
| Q |
418 |
cgttatctttacttgcattgttgagattaagacatgcacaaaaataatgttctgcttttgaacgatatt |
486 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40867092 |
cgttatctttacttgcattgttgagattaagacatgcacaaaaataatgttctgcttttgaacgatatt |
40867160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 183 - 253
Target Start/End: Complemental strand, 37043835 - 37043765
Alignment:
| Q |
183 |
ccataaccaaccaaatagctcatacccattggattagaacccaagatgtaatcaacttgtgattttgcaaa |
253 |
Q |
| |
|
|||||||| || || |||||||| ||| || ||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
37043835 |
ccataacccactaagtagctcatgttcatagggttagagcccaaaatgtaatcaacttgtgattttgcaaa |
37043765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University