View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21222_low_15 (Length: 273)
Name: NF21222_low_15
Description: NF21222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21222_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 39625477 - 39625740
Alignment:
| Q |
1 |
atgatattattaaagcaaacttttggttaggatttatgtggttaattcccttgccatcaagtcttttaatcttagttttcttcttgttgctcatgaggca |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
39625477 |
atgatattataaaagcaaacttttggttaggatttatgtggttaattctcttgccatcaagtcttttaatcatagttttcttcttgttgcttatgaggca |
39625576 |
T |
|
| Q |
101 |
tttcaggaagtaagttcagtttttgtatatgataaatgagaagcactagaaggaaagaaattgactgcttattgtggcaaatataaaatcttggctttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39625577 |
tttcaggaagtaagttcagtttttgtatatgataaatgagaagcactagatggaaagaaattgactgcttattgtggcaaatataaaatcttggctttgg |
39625676 |
T |
|
| Q |
201 |
gcttggttacgaaattgaggtgtaaattggaatttgcaagcgttgtttttcttgacagtattat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
39625677 |
gcttggttacgaaattgaggtgtaaattggaatttgcaagcgttattcttcttgacagtattat |
39625740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 21 - 98
Target Start/End: Complemental strand, 2473888 - 2473811
Alignment:
| Q |
21 |
ttttggttaggatttatgtggttaattcccttgccatcaagtcttttaatcttagttttcttcttgttgctcatgagg |
98 |
Q |
| |
|
||||||||||||||||||||||| | || |||| || ||| | |||||||||||||| | || |||||| | |||||| |
|
|
| T |
2473888 |
ttttggttaggatttatgtggtttactctcttgacaccaactgttttaatcttagttgtatttttgttgattatgagg |
2473811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University