View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21223_high_6 (Length: 261)
Name: NF21223_high_6
Description: NF21223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21223_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 21 - 249
Target Start/End: Original strand, 44945899 - 44946127
Alignment:
| Q |
21 |
gacacacaccaaacaaagtcgaaaaagaaaaggtacatgaatttcgaaaggcttacttacttgtggataaagacagatgcattagaccacaagaaaagag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44945899 |
gacacacaccaaacaaagtcgaaaaagaaaaggtacatgaatttcgaaaggcttacttacttgtggataaagacagatgcattagaccacaagaaaagag |
44945998 |
T |
|
| Q |
121 |
cagcaagagccaaaatcattaaatggcaaacaagagttatgaggttgtattgcatcaactcaaagaaaacccacaaggcagtgccagcaccaagtgcaat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44945999 |
cagcaagagccaaaatcattaaatggcaaacaagagttatgaggttgtattgcatcaactcaaagaaaacccacaaggcagtgccagcaccaagtgcaat |
44946098 |
T |
|
| Q |
221 |
tgctgtgcatttcttgttcctccatagta |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44946099 |
tgctgtgcatttcttgttcctccatagta |
44946127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University