View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21223_low_10 (Length: 218)
Name: NF21223_low_10
Description: NF21223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21223_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 81 - 199
Target Start/End: Original strand, 20365958 - 20366078
Alignment:
| Q |
81 |
gcggcaactctcccgcgcttc---tcttcccagctttttattcccagcttt---tcattatcttcctcactcatccttcaagtttggtgatggacctgca |
174 |
Q |
| |
|
||||||||||||||||| ||| |||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20365958 |
gcggcaactctcccgcgtttcctctcttcccaactttttattcc----tttaggtcattatcttcctcactcatccttcaagtttggtgatggacctgca |
20366053 |
T |
|
| Q |
175 |
acttctcttgatctatacttcttag |
199 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
20366054 |
acttctcttgatctatacttcttag |
20366078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 129 - 199
Target Start/End: Original strand, 50366599 - 50366669
Alignment:
| Q |
129 |
tcattatcttcctcactcatccttcaagtttggtgatggacctgcaacttctcttgatctatacttcttag |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50366599 |
tcattatcttcctcacttatccttcaagtttggtgatggacctgcaacttctcttgatctatccttcttag |
50366669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 131 - 199
Target Start/End: Original strand, 24355714 - 24355782
Alignment:
| Q |
131 |
attatcttcctcactcatccttcaagtttggtgatggacctgcaacttctcttgatctatacttcttag |
199 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||| |||||||| |
|
|
| T |
24355714 |
attatcttcctcactcatcctccaagtttggtgatggacctgaaacttctcttgatatatccttcttag |
24355782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University