View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21223_low_10 (Length: 218)

Name: NF21223_low_10
Description: NF21223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21223_low_10
NF21223_low_10
[»] chr2 (1 HSPs)
chr2 (81-199)||(20365958-20366078)
[»] chr1 (1 HSPs)
chr1 (129-199)||(50366599-50366669)
[»] chr8 (1 HSPs)
chr8 (131-199)||(24355714-24355782)


Alignment Details
Target: chr2 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 81 - 199
Target Start/End: Original strand, 20365958 - 20366078
Alignment:
81 gcggcaactctcccgcgcttc---tcttcccagctttttattcccagcttt---tcattatcttcctcactcatccttcaagtttggtgatggacctgca 174  Q
    ||||||||||||||||| |||   |||||||| |||||||||||    |||   ||||||||||||||||||||||||||||||||||||||||||||||    
20365958 gcggcaactctcccgcgtttcctctcttcccaactttttattcc----tttaggtcattatcttcctcactcatccttcaagtttggtgatggacctgca 20366053  T
175 acttctcttgatctatacttcttag 199  Q
    |||||||||||||||||||||||||    
20366054 acttctcttgatctatacttcttag 20366078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 129 - 199
Target Start/End: Original strand, 50366599 - 50366669
Alignment:
129 tcattatcttcctcactcatccttcaagtttggtgatggacctgcaacttctcttgatctatacttcttag 199  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||    
50366599 tcattatcttcctcacttatccttcaagtttggtgatggacctgcaacttctcttgatctatccttcttag 50366669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 131 - 199
Target Start/End: Original strand, 24355714 - 24355782
Alignment:
131 attatcttcctcactcatccttcaagtttggtgatggacctgcaacttctcttgatctatacttcttag 199  Q
    ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||| ||||||||    
24355714 attatcttcctcactcatcctccaagtttggtgatggacctgaaacttctcttgatatatccttcttag 24355782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University