View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21224_high_9 (Length: 325)

Name: NF21224_high_9
Description: NF21224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21224_high_9
NF21224_high_9
[»] chr8 (1 HSPs)
chr8 (17-120)||(34189418-34189519)


Alignment Details
Target: chr8 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 17 - 120
Target Start/End: Complemental strand, 34189519 - 34189418
Alignment:
17 actttttggtggtagtgtctcaagcgcatgagtctcacacccacatcccaaactgcttttggttcaaccataccaatcgtattgagccctgctatcgcat 116  Q
    |||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||    
34189519 acttttgggtggtagtgtc--aagcgcatgagtctcacacccacatcccaaactgcttttggttcaaccggaccaatcgtattgagccctgctatcgcat 34189422  T
117 tgtt 120  Q
    ||||    
34189421 tgtt 34189418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University