View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21224_low_12 (Length: 289)
Name: NF21224_low_12
Description: NF21224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21224_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 15 - 241
Target Start/End: Complemental strand, 35021588 - 35021351
Alignment:
| Q |
15 |
gagaagaatgtagagagagaaagttgttagagaaatcatgaaggtactgtgatgaaacatgatggtggtgattcttggaaggtgatgagagagagaaagg |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021588 |
gagaagaaggtagagagagaaagttgttagagaaatcatgaaggtactgtgatgaaacatgatggtggtgattcttggaaggtgatgagagagagaaagg |
35021489 |
T |
|
| Q |
115 |
ttt-----------atgaaatgaatgatgaattggttagttagtttagtttagttacagagtttttacaatttggcgggaacgtgattcttgtttctttt |
203 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021488 |
tttttgaagggtttatgaaatgaatgatgaattggttagttagtttagtttagttacagagtttttacaatttggcgggaacgtgattcttgtttctttt |
35021389 |
T |
|
| Q |
204 |
ttgcttttcatattaactaaaactatatatgaatgtgt |
241 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35021388 |
ttgcttttcatattaactataactatatatgaatgtgt |
35021351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University