View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21224_low_18 (Length: 234)
Name: NF21224_low_18
Description: NF21224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21224_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 21 - 189
Target Start/End: Complemental strand, 37623887 - 37623720
Alignment:
| Q |
21 |
taaatttggtccatagaacaaatgacccaaatactat-gaaataatgttgctctctgcaaatgtcatgtggccaccagtacgtcggttgtaggtaataat |
119 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37623887 |
taaatttggtccctagaacaaacgacccaaatactattgaaataatgttgctctctgcaaatatcatgtggccaccagtacgtcggttgtaggtaataa- |
37623789 |
T |
 |
| Q |
120 |
aataaagctggctatgtggccctaatttttccttacttattcttgtcaagttttcacttttcatccacgt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37623788 |
-ataaagctggctatgtggccctaatttttccttacctattcttgtcaagttttcacttttcatccacgt |
37623720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University