View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21224_low_19 (Length: 230)
Name: NF21224_low_19
Description: NF21224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21224_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 216
Target Start/End: Original strand, 50713069 - 50713267
Alignment:
| Q |
18 |
gggatagaaggacaataccattattgtttgcaagttttgattatgataggttttgttacaacccttatgggaattggttttccaaagagttttttggtat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50713069 |
gggatagaaggacaataccattattgtttgcaagttttgattatgataggtttttttacaacccttatgggaattggttttccaaagagttttttggtat |
50713168 |
T |
 |
| Q |
118 |
gttttcttcgttctgttagcatgatcttccaaggtttgttcattatgttcatgggtttagtgctttctagacctggttatcaacccaaaggttgcttct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50713169 |
gttttcttcgttctgttagcatgatcttccaaggtttgttcattatgttcatgggtttagtgctttctagacctggttatcaacccaaaggttgcttct |
50713267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 21 - 214
Target Start/End: Original strand, 50718353 - 50718546
Alignment:
| Q |
21 |
atagaaggacaataccattattgtttgcaagttttgattatgataggttttgttacaacccttatgggaattggttttccaaagagttttttggtatgtt |
120 |
Q |
| |
|
|||||||||||||| ||||||| | |||||||||||| ||| ||||||| |||||||||||||||||||||| ||||| ||| || ||||| ||| |
|
|
| T |
50718353 |
atagaaggacaatatcattatttactacaagttttgatttcgatttgttttgtgacaacccttatgggaattggttatccaatgagcttcttggtgagtt |
50718452 |
T |
 |
| Q |
121 |
ttcttcgttctgttagcatgatcttccaaggtttgttcattatgttcatgggtttagtgctttctagacctggttatcaacccaaaggttgctt |
214 |
Q |
| |
|
|| | || ||||||||||| | |||||||||||||| ||||||||||||| | |||||| || |||||||| | |||| ||||||||||| |
|
|
| T |
50718453 |
ttgtgcgatctgttagcataaccttccaaggtttgtggcttatgttcatggggctcatgctttttacacctggttttgaaccgaaaggttgctt |
50718546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University