View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21225_high_11 (Length: 250)
Name: NF21225_high_11
Description: NF21225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21225_high_11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 35831650 - 35831411
Alignment:
| Q |
11 |
agaatatctaaatatggtaaatcgtgttcgaaaaagcgaatccaaacatgtacaaattgaaggcataaaatttgacaagctaagactagatagataccta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35831650 |
agaatatctaaatatggtaaatcgtgttcgaaaaagcgaatccaaacatgtacaaattgaaggcataaaatttgacaagctaagactagatagataccta |
35831551 |
T |
 |
| Q |
111 |
gtttggttgacagggtaaatgagtatgggaccattacttgtgtccttgagaatattgccatacacttctttagcaaagacatgaatctcactccttggga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35831550 |
gtttggttgacagggtaaatgagtatgggaccattacttgtgtccttgagaatattgccaaacacttctttagcaaagtcatgaatctcactccttggga |
35831451 |
T |
 |
| Q |
211 |
tcagaaggttcagccaaggatggtgaacttcccataagcc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35831450 |
tcagaaggttcagccaaggatggtgaacttcccataagcc |
35831411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University