View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21226_low_10 (Length: 325)
Name: NF21226_low_10
Description: NF21226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21226_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 8931298 - 8931526
Alignment:
| Q |
18 |
accacgacgtttccccttgtaacaaaataaacatggaagatgatttttcttatgtacnnnnnnnn--gtaagagcatatatttttcttatctact----t |
111 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
8931298 |
accacgacgtttccccttataacaaaatatacatggaagatgatttttgttatgtacttttttttttgtaagagcatatatttttcttatctacttactt |
8931397 |
T |
 |
| Q |
112 |
aaatcatgtgagtgatgataaaatcaacaatcatgcatggctattttttcacattgcgacaaattaaccagtgtttatcaatcatcatactaaatgcttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931398 |
aaatcatgtgagtgatgataaaatcaacaatcatgcatggctattttttcacattgcgacaaattaaccagtgtttatcaatcatcatactaaatgcttc |
8931497 |
T |
 |
| Q |
212 |
tccactcaacgagagaaacaattcattcc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8931498 |
tccactcaacgagagaaacaattcattcc |
8931526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University