View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21226_low_18 (Length: 237)
Name: NF21226_low_18
Description: NF21226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21226_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 16114498 - 16114268
Alignment:
| Q |
1 |
gacacattcacatgcaaaatctgataagaaaatttaacactagcatggggtgatggtccatta---------ttatttgattattaattggggagataaa |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16114498 |
gacacattcacatgcaaaatctgataagaaaatttaacactagcatggggtgatggtccattaattatatttttatttgattattaattggggagataaa |
16114399 |
T |
 |
| Q |
92 |
tttgggacagaaagggagcatcttcctgaaaacattctctcgttttcacactggtcattgctcacgtgacacttgccatgtgatgtgatcaagattattg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16114398 |
tttgggacagaaagggagcatcttcctgaaaacattctctcgttttcacaatggtcattgctcacgtgacacttgccatgtgatgtgatcaagattattg |
16114299 |
T |
 |
| Q |
192 |
tataaaaacaaacttcatctatacatttcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16114298 |
tataaaaacaaacttcatctatacatttcat |
16114268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University