View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21226_low_20 (Length: 226)

Name: NF21226_low_20
Description: NF21226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21226_low_20
NF21226_low_20
[»] chr1 (2 HSPs)
chr1 (1-133)||(29020672-29020805)
chr1 (155-222)||(29020491-29020558)


Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 29020805 - 29020672
Alignment:
1 cttatcattaaaaagtagcccttattatgcaagccaccatacaaggtgaagaaaagcaaatttagtattatgatgaaggtaagttcgaccgtaaggtgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29020805 cttatcattaaaaagtagcccttattatgcaagccaccatacaaggtgaagaaaagcaaatttagtattatgatgaaggtaagttcgaccgtaaggtgat 29020706  T
101 ataagtatag-tttacacatattgttttatcaag 133  Q
    |||||||||| ||||| |||||||||||||||||    
29020705 ataagtatagttttactcatattgttttatcaag 29020672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 155 - 222
Target Start/End: Complemental strand, 29020558 - 29020491
Alignment:
155 attcctagttgcggaagctatgaaaatgattaactaaatgagttcaattttatgctgattgctaaatg 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
29020558 attcctagttgcggaagctatgaaaatgattaactaaatgagttcaattttatgctgattgttaaatg 29020491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University