View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21226_low_20 (Length: 226)
Name: NF21226_low_20
Description: NF21226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21226_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 29020805 - 29020672
Alignment:
| Q |
1 |
cttatcattaaaaagtagcccttattatgcaagccaccatacaaggtgaagaaaagcaaatttagtattatgatgaaggtaagttcgaccgtaaggtgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29020805 |
cttatcattaaaaagtagcccttattatgcaagccaccatacaaggtgaagaaaagcaaatttagtattatgatgaaggtaagttcgaccgtaaggtgat |
29020706 |
T |
|
| Q |
101 |
ataagtatag-tttacacatattgttttatcaag |
133 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||| |
|
|
| T |
29020705 |
ataagtatagttttactcatattgttttatcaag |
29020672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 155 - 222
Target Start/End: Complemental strand, 29020558 - 29020491
Alignment:
| Q |
155 |
attcctagttgcggaagctatgaaaatgattaactaaatgagttcaattttatgctgattgctaaatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29020558 |
attcctagttgcggaagctatgaaaatgattaactaaatgagttcaattttatgctgattgttaaatg |
29020491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University