View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21226_low_4 (Length: 501)
Name: NF21226_low_4
Description: NF21226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21226_low_4 |
 |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0016 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 219 - 485
Target Start/End: Complemental strand, 71596 - 71330
Alignment:
| Q |
219 |
gttgtcaatctttgctttttctaaatcggaagtttgtaccaatccagttctagaaacctctaaataagttgaaccaatccgtcccaaatgcaacaacatt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
71596 |
gttgtcaatctttgctttttctaaatcgaaagtt-gtaccaatccagttctagaaacctctaaataagttgaaccaatccgtcccaaatgcaacaacatt |
71498 |
T |
 |
| Q |
319 |
cgttaccaataattgcttaaagtttatgacagctctcccgactacacttcctcataacttgttatttgatgtgttgaaaccactcttgggataatttgaa |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
71497 |
cgttaccaataattgcttaaagtttatgacagctctcccgactacacttcctcataacttattatttgatgtgttgaaaccactcttgggataatttgaa |
71398 |
T |
 |
| Q |
419 |
gctccatcttggtaaaatttaaaatattaaaatctccatt-tcaggttggaataaaatgagagatttc |
485 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
71397 |
gctccatcttggtaaaatttaaaatattaaaatctccattatcaggttggaataaaatgagagatttc |
71330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 134
Target Start/End: Complemental strand, 70004 - 69968
Alignment:
| Q |
97 |
ttttttaatcgataattgtattgtttttaacttagttt |
134 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
70004 |
ttttttaat-gataattgtattgtttttaacttagttt |
69968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University