View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21227_high_9 (Length: 277)
Name: NF21227_high_9
Description: NF21227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21227_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 19587868 - 19587684
Alignment:
| Q |
1 |
catgcatagatcttgttcttgtttgccgatttgacgatgattgcagtttttgattggcatagaatagatagctctattgctttgttgaaaattccgagtc |
100 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19587868 |
catgcatagaacttgttcttgtttggcgatttgacgatgattgcagtttttgattggcatagaatagatagctctattgctttgttgaaaattccgagtc |
19587769 |
T |
 |
| Q |
101 |
tgcgttctttttcatctaatttcttgatttcatgcatctttctcttccgtgtgttgttgagttttgttccagcattctttctctc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19587768 |
tgcgttctttttcatctaatttcttgatttcatgcatctttctcttccgtgtgttgttgagttttgttccagcattctttctctc |
19587684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 19587683 - 19587636
Alignment:
| Q |
207 |
ttcagacagttcacaattcttattcatgtttgtttcattcaacgtcac |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19587683 |
ttcagacagttcacaattcttattcatgtttgtttcattcaacatcac |
19587636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 34 - 99
Target Start/End: Complemental strand, 12895308 - 12895243
Alignment:
| Q |
34 |
acgatgattgcagtttttgattggcatagaatagatagctctattgctttgttgaaaattccgagt |
99 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12895308 |
acgatgagtgcagtttctgattcgcatagaatagatagctctattgctttgttgaaaattccgagt |
12895243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 158
Target Start/End: Complemental strand, 12895207 - 12895169
Alignment:
| Q |
120 |
tttcttgatttcatgcatctttctcttccgtgtgttgtt |
158 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
12895207 |
tttcttgatttcatccttctttctcttccgtgtgttgtt |
12895169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University