View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21227_low_14 (Length: 218)
Name: NF21227_low_14
Description: NF21227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21227_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 29113154 - 29112956
Alignment:
| Q |
1 |
ctaaatttgaaatgccaaatcattagttttagcattgccacattgaactggttatgcatggaataccaggaaaagaatctgtatcagcagagaagtttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29113154 |
ctaaatttgaaatgccaaatcattagttttagcattgccacattgaactggttatgcatggaataccaggaaaagaatctgtatcagcggagaagtttga |
29113055 |
T |
 |
| Q |
101 |
caatggtatgacaaatgatttgattcttgaagtgcagtattttgtccttgatgcaatccttgagttattctgccaacgagaggaattcattgttgaaat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
29113054 |
caatggtatgacaaatgatttgattcttgaagtgcaatattttgtccttgatgcaatccttgagttattctgccaatgagaggaattcattgatgaaat |
29112956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 33312738 - 33312934
Alignment:
| Q |
1 |
ctaaatttgaaatgccaaatcattagttttagcattgccacattgaactggttatgcatggaataccaggaaaagaatctgtatcagcagagaagtttga |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33312738 |
ctaaatttgaaatggcaaatcattagttttagctttgccacattgaactgattatgcatggaataccaggaaaagaatctgtatcagcagagaagtttga |
33312837 |
T |
 |
| Q |
101 |
caatggtatgacaaatgatttgattcttgaagtgcagtattttgtccttgatgcaatccttgagttattctgccaacgagaggaattcattgttgaa |
197 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
33312838 |
caatggtatgaaaaatgatttgattcttgaagtgcaatattttgtccttgatgcaatccttgagttattctgcgaatgagaggaattcattgatgaa |
33312934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University