View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21227_low_7 (Length: 402)
Name: NF21227_low_7
Description: NF21227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21227_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 8005391 - 8005569
Alignment:
| Q |
1 |
aaaatatataagcctcccttatttgcttctagatcggaattattttgaaccaatttccttccaatttattcgaaaagcctttcaccaccataaaatgaaa |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8005391 |
aaaatacataagcctcccttatttgcttccagatcggaattattttgaaccaatttccttccaatttattcgaaaagcctttaaccaccataaaatgaaa |
8005490 |
T |
|
| Q |
101 |
gtgaacattcttttcttctaccaattaatatcttgttggtacgttgcttcacaaccagcaagtgttcttcctcaattactggg |
183 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8005491 |
gtgaacattcttttcttctacc----aatatcttgttggtacgttgcttcacaaccagcaagtgttcttcctcaattactggg |
8005569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 247 - 356
Target Start/End: Original strand, 8005633 - 8005735
Alignment:
| Q |
247 |
tggcaatcacaccgacccccaagtgcactgttagcgttattaattcactcgccattgtttatgaaaatgaaatttgtcgatccaccgtcacactggggaa |
346 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
8005633 |
tggcaatcacaacgacccccaagtgcactgttaacgttattaattcactcgccattgtttatgaaaatgaaatttgt-------ccgtcacattggggaa |
8005725 |
T |
|
| Q |
347 |
aaccgatcat |
356 |
Q |
| |
|
|||||||||| |
|
|
| T |
8005726 |
aaccgatcat |
8005735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 305 - 362
Target Start/End: Original strand, 9849178 - 9849235
Alignment:
| Q |
305 |
ttatgaaaatgaaatttgtcgatccaccgtcacactggggaaaaccgatcataaattg |
362 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||| ||||||| || |||||||| |
|
|
| T |
9849178 |
ttatgaaaatgaaatttgtcgatccaccgatacattggtgaaaaccaataataaattg |
9849235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University