View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21228_high_11 (Length: 246)
Name: NF21228_high_11
Description: NF21228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21228_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 2 - 233
Target Start/End: Complemental strand, 32502550 - 32502319
Alignment:
| Q |
2 |
gatctatcataggaaattttcttaacaacttctttaagatgctaatggctatttagagggattggcaacataattctcattgatatccttgcagaatcag |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32502550 |
gatctatcataggaaattttcttaacaacttctttaagatgctaatggctatttagagggattggcaacataattctcattgatatccttgcagaatcag |
32502451 |
T |
|
| Q |
102 |
agggattgcactccattcacatttgtcctggaaatcttttattcgctttctattttccacttgtacttccctgtatgattgatctatttaaatatagcat |
201 |
Q |
| |
|
|| ||||||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32502450 |
agagattgcactccattcgcatttgtccatgaaatcttttattctctttctattttccacttgtacttccctgtatgattgatctatttaaatatagcag |
32502351 |
T |
|
| Q |
202 |
agnnnnnnnacattcttgatgccttccctttg |
233 |
Q |
| |
|
|| ||||||||||||||||||||||| |
|
|
| T |
32502350 |
agtttttttacattcttgatgccttccctttg |
32502319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University