View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21228_low_12 (Length: 251)
Name: NF21228_low_12
Description: NF21228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21228_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 20 - 243
Target Start/End: Complemental strand, 41593850 - 41593627
Alignment:
| Q |
20 |
gattgcagtctttcaaaagatccacttcagaatcaactttggagaagctatctgacatctttgggtcattttcaatattttcacaaagggaggaacctaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41593850 |
gattgcagtctttcaaaagatccacttcagaatcaactttggagaagctatctgacatatttgggtcattttcaatattttcacaaagggaggaacctaa |
41593751 |
T |
 |
| Q |
120 |
aggtacaacaaattccttacatcttcaaatccatggtgaattagagctagattcataatcaaccaaaagctttttcaatctttaatacagggtttttctg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41593750 |
aggtacaacaaattccttacatcttcaaatccatggtgaattagagctagattcataatcaaccaaaagctttgtcaatctttaatacagggtttttctg |
41593651 |
T |
 |
| Q |
220 |
ccttgttctggtctgaagaataat |
243 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
41593650 |
ccttgttctggtctgaagattaat |
41593627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 63
Target Start/End: Original strand, 876872 - 876915
Alignment:
| Q |
20 |
gattgcagtctttcaaaagatccacttcagaatcaactttggag |
63 |
Q |
| |
|
||||| ||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
876872 |
gattggagtctttcaaaagatccacttcagagtgaactttggag |
876915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University