View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21229_high_15 (Length: 204)
Name: NF21229_high_15
Description: NF21229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21229_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 24 - 191
Target Start/End: Original strand, 26495495 - 26495662
Alignment:
| Q |
24 |
tcttccatggcacaatctttgccggaacgcgcaccaccgtgcctttccgatgatgatgacaacactcatgattttgtatcttctcttctttttcaacagg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26495495 |
tcttccatggcacaatctttgccggaacgcgcaccaccgtgcctttccgatgatgatgacaacactcatgattttgtatcttctcttctttttcaacagg |
26495594 |
T |
|
| Q |
124 |
agatacccttcttctccctctaaatggtaacaaaagtaccataacaatagctgataataacacaaaaa |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26495595 |
agatacccttcttctccctctaaatggtaacaaaagtaccataacaatagctgatattaacacaaaaa |
26495662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University