View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21229_low_11 (Length: 258)
Name: NF21229_low_11
Description: NF21229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21229_low_11 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 15 - 258
Target Start/End: Original strand, 8930775 - 8931017
Alignment:
| Q |
15 |
tttttaatatagaatgattttcttcttatgacaaattttgtctttgttaaaatgtagtagcattagcatatatccatgcataaacagtaagtt-attatt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
8930775 |
tttttaatatagaatgattttcttcttatgacaaattttgtctttgttaaaatgtagtagcattagcatat--ccatgcataaacagtaagtttattatt |
8930872 |
T |
|
| Q |
114 |
tgatagtagttgatgaacctgtggcaaatatgtgaatgagtttattacgaataaactaacagataaaatttaaagtttactagtttaaaagtgaatagtt |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8930873 |
tgatagtagttgatgaacctgtgacaaatatgtgaatgagtttattacgattaaactaacagataaaatttaaagtttactagtttaaaagtaaatagtt |
8930972 |
T |
|
| Q |
214 |
gaaccaattatattgcaacccaccaaagggcaagctgttagtttc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8930973 |
gaaccaattatattgcaacccaccaaagggcaagctgttagtttc |
8931017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University