View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21231_high_10 (Length: 318)
Name: NF21231_high_10
Description: NF21231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21231_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 131 - 304
Target Start/End: Complemental strand, 36569612 - 36569448
Alignment:
| Q |
131 |
aattatgaactaagaattttagtgctgtgaatctatctatctatctattattcgtaaatggatgatagtcatgctcgtgcaaaccttaattttcatattt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36569612 |
aattatgaactaagaattttagtgctgtgaatctatctat--------tattcgtaaatggatgatagtcatgctcgtgcaaaccttaattttcatattt |
36569521 |
T |
 |
| Q |
231 |
tgtccnnnnnnnnnncaattcatttcaatttttccccttccatcttatcttacgtaccttttaccactataact |
304 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36569520 |
tgtcc-tttttttttcaattcatttcaatttttccccttccctcttatcttacgtaccttttaccactataact |
36569448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 36570148 - 36570073
Alignment:
| Q |
1 |
ttggaaaaatttaggtggaaggatagaagatataggcaataaggttgaaattgtttgatatttatgggggcgattg |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36570148 |
ttggaaaaatttaggtggaaggatagaagatataggcaataaggttgagattgtttgatatttatgggggcgattg |
36570073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University