View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21231_high_17 (Length: 215)
Name: NF21231_high_17
Description: NF21231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21231_high_17 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 32177488 - 32177274
Alignment:
| Q |
1 |
acttcttttttcccctctcaataaaatcactcaaaaactttctctccctaattacatcttgaacacttcttcttctgctatgttctccttattctctcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32177488 |
acttcttttttcccctctcaataaaatcactcaaaaactttctctccctaattacatcttgaacacttcttcttctgctatgttctccttattctctcat |
32177389 |
T |
|
| Q |
101 |
ttccctactcttactcaatccttatccttacaagaacaagaatatgatgcttctgatggggttctagttccaggcattccattttcacctttaccatatt |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32177388 |
ttccctactcttgctcaatccttatcctcacaagaacaagaatatgatgcttctgatggggttctagttccaggcattccattttcacctttaccatatt |
32177289 |
T |
|
| Q |
201 |
catctatcccaccat |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32177288 |
catctatcccaccat |
32177274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 32184499 - 32184452
Alignment:
| Q |
166 |
agttccaggcattccattttcacctttaccatattcatctatcccacc |
213 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32184499 |
agttccaggtattgcattttcacctttaccatattcatctatcccacc |
32184452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 120
Target Start/End: Complemental strand, 32184631 - 32184536
Alignment:
| Q |
25 |
aatcactcaaaaactttctctccctaattacatcttgaacacttcttcttctgctatgttctccttattctctcatttccctactcttactcaatc |
120 |
Q |
| |
|
|||||||||| |||||||||| ||||| || | |||| |||||||| || | ||||||||||| || ||||| |||||||||||| ||||||| |
|
|
| T |
32184631 |
aatcactcaacaactttctctacctaactataccttgtttacttcttcagcttccatgttctccttcttttctcacttccctactcttgctcaatc |
32184536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University