View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21231_low_16 (Length: 260)
Name: NF21231_low_16
Description: NF21231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21231_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 9 - 244
Target Start/End: Original strand, 12312075 - 12312310
Alignment:
| Q |
9 |
agcagagagggtttgctacatttcttttcaaattgtagttctaataatttgcataaactcgattttcgtttacctatggaccttgaaaacaatcatctat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12312075 |
agcagagagggtttgctacatttcttttcaaattgtagttctaataatttgcataaactcgattttcgtttacctatggaccttgaaaacaatcatctat |
12312174 |
T |
 |
| Q |
109 |
ttgctattgctatgactacaaattttcgaggcctttcgagtattaggcttcaaagttgttgtcttgtaactggtgaagggcttaaggttctaagtgtagc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12312175 |
ttgctattgctatgactacaaattttcgaggcctttcgagtattaggcttcaaagttgttgtcttgtaactggtgaagggcttaaggttctaagtgtagc |
12312274 |
T |
 |
| Q |
209 |
aatgagtaatggtcttgaagaattggcactcataaa |
244 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12312275 |
attgagtaatggtcttgaagaattggcactcataaa |
12312310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 45 - 123
Target Start/End: Complemental strand, 12235173 - 12235096
Alignment:
| Q |
45 |
agttctaataatttgcataaactcgattttcgtttacctatggaccttgaaaacaatcatctatttgctattgctatga |
123 |
Q |
| |
|
||||||||||||| ||||||||| |||||||| ||| | |||||||||||| || ||||||||||| ||| ||||||| |
|
|
| T |
12235173 |
agttctaataatt-gcataaacttgattttcgattatccatggaccttgaataccatcatctattttatatggctatga |
12235096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University