View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21231_low_17 (Length: 224)
Name: NF21231_low_17
Description: NF21231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21231_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 42 - 193
Target Start/End: Original strand, 37765725 - 37765876
Alignment:
| Q |
42 |
aatgtaagttgtttgtccttgctttgaagattgtgatgatgacctggttcacgggcctcaaggataaatccatcgatttatggaagacaatgtgtgaaaa |
141 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
37765725 |
aatgtaagttatttgtccttgctttgaagattgcgatgatgacctggttcacgggcctcaaggataaatccatcaatttatggaagacaatgtgtgaaga |
37765824 |
T |
 |
| Q |
142 |
gttcacttcacactttaccacccgagagtcaaccaaacactaaggttgccta |
193 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37765825 |
gttcacttcgcactttaccacccgagagtcaaccaaacactaaggttgccta |
37765876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University