View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21232_high_3 (Length: 240)
Name: NF21232_high_3
Description: NF21232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21232_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 60 - 225
Target Start/End: Complemental strand, 6627469 - 6627304
Alignment:
| Q |
60 |
gattcaaggaggagctcgcgcggcacgtggtttttcggcaacggtaaaaaatcaacgcgatcaaggaagctacgacacgtggatgatgctaacattgaat |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6627469 |
gattcaaggaggagctcgcgcggcacgtggtttttcggcaacggtaaaaaatcaacgcgatcaaggaagctacgacacgtggatgatgctaacgttgaat |
6627370 |
T |
|
| Q |
160 |
actcaaccgcaccgattcaacggtctccgagtgcacggggttatattcggtctaatacttcttcct |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6627369 |
actcaaccgcaccgattcaacggtctccgagtgcacggggttatattcggtctaatacttcttcct |
6627304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University