View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21233_high_25 (Length: 392)
Name: NF21233_high_25
Description: NF21233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21233_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 14 - 265
Target Start/End: Complemental strand, 32709649 - 32709398
Alignment:
| Q |
14 |
cacaaagaagggaagcttctaatttctaatgccccctactcaagtgtgaaacttttttgtctgcaaatcttaataatcttctcataaatgattggaacaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32709649 |
cacaaagaagggaagcttctaatttctaatgccccctactcaagtgtgaaacttttttgtctgcaaatcttaataatcttctcataaatgattggaacaa |
32709550 |
T |
 |
| Q |
114 |
gagaatttacatgtactacaactactagggcatgaaaaccttcaacttcctcttcttcctacctccaacaacattgcctatcggtgagttctgttttctc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32709549 |
gagaatttacatgtactacaactactagggcatgaaaaccttcaacctcctcttcttcctacctccaacaacattgcctatcggtgagttctgttttctc |
32709450 |
T |
 |
| Q |
214 |
gaacccaacttcaaaaattctatcttttcacaatcctctttaatgggttgcg |
265 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32709449 |
gaacccagcttcaaaaattctatcttttcacaatcctctttaatgggttgcg |
32709398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 373
Target Start/End: Complemental strand, 32709323 - 32709290
Alignment:
| Q |
340 |
actcattattacttgagatgactttctgggtcta |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32709323 |
actcattattacttgagatgactttctgggtcta |
32709290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University