View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21233_high_27 (Length: 369)
Name: NF21233_high_27
Description: NF21233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21233_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 7 - 352
Target Start/End: Complemental strand, 45025413 - 45025068
Alignment:
| Q |
7 |
gagagatgaaggtatagcaagcctaaggaaaacaaagagatcctgcagagctctctttgaaaaccctgtccatgtttgtttacaagtagaagaaaatttt |
106 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45025413 |
gagagctgaaggtatagcaagtctaaggaaaacaaagagatcctgcagagctctctttgaaaaccctgtccatgtttgtttacaagtagaagaaaatttt |
45025314 |
T |
 |
| Q |
107 |
acatagagtgaaatcaacaacacattgacccaataacatatagaattggatatagctgcccctttacttccaagcttaaattcaaaaaccaaaagccaac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45025313 |
acatagagtgaaatcaacaacacattgacccaataacatatagaattggatatagctgcccctttacttccaagcttaaattcaaaaaccaaaagccaac |
45025214 |
T |
 |
| Q |
207 |
acaaaagggtatgaagcaaagctgcaatcccagaagttatcaccattgggaggacaatgttttgtgtttgcaagaacttgagaatgcactggagaggacc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45025213 |
acaaaagggtatgaagcaaagctgcaatcccagaagttatcaccattgggaggacaatgttttgtgtttgcaagaacttgagaatgcactggagaggacc |
45025114 |
T |
 |
| Q |
307 |
atatgcgaacaaactcggtatcagaaacaacgcgtatgaaccagct |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45025113 |
atatgcgaacaaactcggtatcagaaacaacgcgtatgaaccagct |
45025068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University