View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21233_high_35 (Length: 314)
Name: NF21233_high_35
Description: NF21233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21233_high_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 210
Target Start/End: Complemental strand, 33186786 - 33186589
Alignment:
| Q |
13 |
aatatcacaggacacagatggcgagctacatacttggctttccatatggttagtgatcttcataaataaacctttatttgaccacatatatataatatgg |
112 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33186786 |
aatatcacaggacatagatggcgagctacatacttggctttccatatggttagtgatcttcataaataaacctttatttgaccacatatatataatatgg |
33186687 |
T |
 |
| Q |
113 |
tattgataacactaaaaaacaaattacattttcacaaaccaatagtgtatgctatatgtgtcactatcattctcatacatttatatctcaaaattgaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33186686 |
tattgataacactaaaaaacaaattacattttcacaaaccaatagtgtatgctatatgtgtcactatcattctcatacatttatatctcaaaattgaa |
33186589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 235 - 297
Target Start/End: Complemental strand, 33186560 - 33186498
Alignment:
| Q |
235 |
gtttgaaataatgaattaacttcattttatgcatacccacaaaacccatttccacaaggatca |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33186560 |
gtttgaaataatgaattaacttcattttatgcatacccacaaaacccatttccacaaggatca |
33186498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University