View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21233_high_43 (Length: 272)
Name: NF21233_high_43
Description: NF21233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21233_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 9e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 113 - 256
Target Start/End: Complemental strand, 47365736 - 47365593
Alignment:
| Q |
113 |
gtattaaatatgtgaaatttgcatataaaattctagtatctgttcctaagttcaccttcagtttgtctgtccttaattgtactatgtttgtcacaaaaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365736 |
gtattaaatatgtgaaatttgcatataaaattctagtatctgttcctaagttcaccttcagtttgtctgtccttaattgtactatgtttgtcacaaaaat |
47365637 |
T |
 |
| Q |
213 |
aattgagcatttagcagaaggggaaaactatgaaaaaagggttt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365636 |
aattgagcatttagcagaaggggaaaactatgaaaaaagggttt |
47365593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 10 - 56
Target Start/End: Complemental strand, 47365839 - 47365793
Alignment:
| Q |
10 |
aagaatatagtaaggtgacttcagtttgtcaatctaatccactaaag |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365839 |
aagaatatagtaaggtgacttcagtttgtcaatctaatccactaaag |
47365793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University