View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21233_high_44 (Length: 264)
Name: NF21233_high_44
Description: NF21233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21233_high_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 257
Target Start/End: Original strand, 1610260 - 1610499
Alignment:
| Q |
18 |
agaatcctggttcaagagctgatacaactaatgaaacttgttgcttagttttgagagtctcgatcagcttctgcacaacacgagtgttgtgggaaggaga |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1610260 |
agaatcctggttcaagagctgatacgactaatgaaacttgttgcttagttttgagagtctcgatcagcttctgcacaacacgagtgctgtgggaaggaga |
1610359 |
T |
|
| Q |
118 |
gaacaatgaggtcaagttcagcattagataataagtacattatttcatattaattataaaatagttgcatgactacccgtgagtatttaacgagattctg |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1610360 |
gaacaatgaggtcaagttcaacattagataataagtacattatttcatattagttataaaatagttgcatgactacccgtgagtatttaacgagattctg |
1610459 |
T |
|
| Q |
218 |
acaagctgccccggctcctggataaccatcagtataatct |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1610460 |
acaagctgccccggctcctggataaccatcagtatgatct |
1610499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University