View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21233_high_48 (Length: 255)
Name: NF21233_high_48
Description: NF21233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21233_high_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 254
Target Start/End: Complemental strand, 249501 - 249264
Alignment:
| Q |
17 |
aatatatacataatatggtagcagctaattttgtcaaagtgcttgattccaatattccacatggatccaattggtttcttccttcttctgacatctctgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
249501 |
aatatatacataatatggtagcagctaattttgtcaaagtgcttgattccaatattccacatggatccaattggtttcttccttcttctgacatctctgc |
249402 |
T |
|
| Q |
117 |
tgttcagttatccatttgttctcattgctcaatctcccacaaccactatcagtgttgagggaattgtttattgtgatgcctgctcaaccggcactttctc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
249401 |
tgttcagttatccatttgttctcattgctcaatctcccacaaccactatcagtgttgagggaattgtttattgtgatgcctgctcaaccggcactttctc |
249302 |
T |
|
| Q |
217 |
taaacacagttatctcttgccaggtatgtatgcatgta |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
249301 |
taaacacagttatctcttgccaggtatgtatgtatgta |
249264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University