View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21233_high_55 (Length: 241)
Name: NF21233_high_55
Description: NF21233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21233_high_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 17 - 223
Target Start/End: Original strand, 1623950 - 1624156
Alignment:
| Q |
17 |
aaagcaaacaaattaatctctttaaagactatatatgtgacaatttaaagtatacaagaggttgaagggaggaagcagtgtgattgtttgattgattaga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
1623950 |
aaagcaaacaaattaatctctttaaagactatatatgtgacaatttaaagtatcaaagaggttgaagggaggaagcagtgcgattgtctgattgattaga |
1624049 |
T |
 |
| Q |
117 |
gcaaaaccgatgaacagtaaccctctaagggtttgatgccgccagcaacggttggctaccatcttcctctggatctgtcgtatccctcttcgattctcgg |
216 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1624050 |
gcaaaaccgatgagcagtaaccctctaagggtttgatgccgccggcaacggttggctaccatcttcctccggatctgtcgtatccctcttcgattctcgg |
1624149 |
T |
 |
| Q |
217 |
cgttttg |
223 |
Q |
| |
|
||||||| |
|
|
| T |
1624150 |
cgttttg |
1624156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 24 - 73
Target Start/End: Original strand, 1630770 - 1630819
Alignment:
| Q |
24 |
acaaattaatctctttaaagactatatatgtgacaatttaaagtatacaa |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1630770 |
acaaattaatctctttaaagactatatatgtgacaatttaaagtatacaa |
1630819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University