View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21233_high_57 (Length: 238)
Name: NF21233_high_57
Description: NF21233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21233_high_57 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 37391545 - 37391766
Alignment:
| Q |
18 |
ggttcaaattccacactgaaatgtatagtttagtcactggtggctatcctttgctacataaaaaccgtgttaattttattctcaaaacttttattttatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37391545 |
ggttcaaattccacactgaaatgtatagtttagtcactggtggctatcctttgctacataaaaaccgtgttaattttattctcaaaacttttattttatt |
37391644 |
T |
 |
| Q |
118 |
acattcaa-aagaaagttcctttctaagtttcaaaatctgaatttgaatcctatatgcttcttttaacaagaatatcaaacacgattaaaattagtaatt |
216 |
Q |
| |
|
|||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37391645 |
acatgcaataagaaagtttctttctaagtttcaaaatctgaatttgaatcctatatgcttcttttaacaagaatatcaaacacgattaaaattagtaatc |
37391744 |
T |
 |
| Q |
217 |
agtggttggattgaagtggtaa |
238 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
37391745 |
agtggttggatcgaagtggtaa |
37391766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University