View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21233_high_66 (Length: 230)
Name: NF21233_high_66
Description: NF21233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21233_high_66 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 31 - 210
Target Start/End: Original strand, 27897801 - 27897980
Alignment:
| Q |
31 |
ttttcttggctaatacgtatgtcacaaagttggtttaaggatcatcacgtgtacagtgtgccccatacaagtaaaacattttgggtaatgtcggttgggg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27897801 |
ttttcttggctaatacgtatgtcacaaagttggtttaaggatcatcacgtgtacagtgtgccccatacaagtaaaacattttgggtaatgtcggttgggg |
27897900 |
T |
|
| Q |
131 |
tatgatgcacgtgcgggttacactttcaattgacatgcagcttcaattcacaattaggtaggggaaggggagatgtactt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27897901 |
tatgatgcacgtgcgggttacactttcaattgacatgcagcttcaattcacaattaggtaggggaaggggagatgtactt |
27897980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University