View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21233_low_13 (Length: 508)
Name: NF21233_low_13
Description: NF21233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21233_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 2e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 249 - 431
Target Start/End: Original strand, 56164283 - 56164458
Alignment:
| Q |
249 |
aaattattgattgatcacatgaatatataattgcatcgaaaccccagttcatcagtgacattgtgctacgacaaattgctttgatcttaattttgtaatt |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| |||||| ||||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
56164283 |
aaattattgattgatcacatgaatatataattgcatcgaaa-cccttttcatccgtgacgttgtatgacgagaaattgctttgatcttaattttgtaatt |
56164381 |
T |
|
| Q |
349 |
gctatcaatatcatgtcttcttctcaaccatatcgatccattccaacagaagacagggttagctccattccagattcaattct |
431 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
56164382 |
gc------tatcatgtcttcttctcaaccatatcgattcattccaacagaagatagggttagctccattccagattcaattct |
56164458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 444 - 492
Target Start/End: Complemental strand, 56164712 - 56164664
Alignment:
| Q |
444 |
ctctttgtattgctgcattaataaatctgttgatattgttgatgctgta |
492 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
56164712 |
ctctttgtattgctgcattaataaatctgttgatatcgttgatgctgta |
56164664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 387 - 449
Target Start/End: Original strand, 44253227 - 44253289
Alignment:
| Q |
387 |
cattccaacagaagacagggttagctccattccagattcaattctgtctcacattctctcttt |
449 |
Q |
| |
|
||||||||| ||||| ||| |||||||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
44253227 |
cattccaaccgaagataggattagctcctttccagattcaattatatctcacattctctcttt |
44253289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University