View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21233_low_37 (Length: 318)
Name: NF21233_low_37
Description: NF21233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21233_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 202 - 303
Target Start/End: Complemental strand, 40811124 - 40811023
Alignment:
| Q |
202 |
caccttcatttgtaagagctgaaatcacacaacaatttcaactattaagccaaaagctacgccttccgtttattcaaaactaaaatgtaaacatgaaaaa |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40811124 |
caccttcatttgtaagagctgaaatcacacaacaatttcaactattaagccaaaagctacgtcttgcgtttattcaaaactaaaatgtaaacatgaaaaa |
40811025 |
T |
 |
| Q |
302 |
gt |
303 |
Q |
| |
|
|| |
|
|
| T |
40811024 |
gt |
40811023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 26 - 118
Target Start/End: Original strand, 32535038 - 32535130
Alignment:
| Q |
26 |
ttatctgtttttaataaattttgaagtagaaaacctacccctcctctattttttgggttcaaaattatactactaaaaaactagcttaggtct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32535038 |
ttatctgtttttaataaattttgaagtagaaaacctacccctcctctattttttgggttcaaaattatactactaaaaaactagcttaggtct |
32535130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 100 - 145
Target Start/End: Original strand, 32535139 - 32535184
Alignment:
| Q |
100 |
aaaaaactagcttaggtctcttcttttattggtgatcatttaggtc |
145 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32535139 |
aaaaaattagcttaggtctcttcttttattggcgatcatttaggtc |
32535184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University