View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21233_low_73 (Length: 216)

Name: NF21233_low_73
Description: NF21233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21233_low_73
NF21233_low_73
[»] chr1 (1 HSPs)
chr1 (106-200)||(38838010-38838104)


Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 106 - 200
Target Start/End: Complemental strand, 38838104 - 38838010
Alignment:
106 caggattaagtgcaagccactcggtgtcaaacccaataacctttgtcttatgattggaattacttgttgaaccaaaagaaaaaatatggtcatcc 200  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38838104 caggattaggtgcaagccactcggtgtcaaacccaataacctttgtcttatgattggaattacttgttgaaccaaaagaaaaaatatggtcatcc 38838010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University