View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21234_low_4 (Length: 382)
Name: NF21234_low_4
Description: NF21234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21234_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 193 - 366
Target Start/End: Original strand, 16791606 - 16791779
Alignment:
| Q |
193 |
caattttctttctgttttctgtactatgcagtttagactaatagtagctatacatgctactcatagactatatgcaatattaacaaactatacacaaaat |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16791606 |
caattttctttctgttttctgtactatgcagtttagactaatagtagctatacatgctactcatagactatatgcattattaacaaactatacacaaaat |
16791705 |
T |
|
| Q |
293 |
acaattttttcctctctttttctcccccnnnnnnnttaaagaatatctctttgtaaaaatacaattcagcacag |
366 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16791706 |
acaattgtttcctctctttttctcccccaaaaaaattaaagaatatctctttgtaaaaatacaattcagcacag |
16791779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 16791419 - 16791490
Alignment:
| Q |
18 |
gtccataccaactgaactgagctaagctcacgaggacagtgattgcttaatctaaatatacaaaaagtagtc |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16791419 |
gtccataccaactgaactgagctaagctcacgacgacagtgattgcttaatctaaatatacaaaaagtagtc |
16791490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University