View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21235_low_22 (Length: 372)
Name: NF21235_low_22
Description: NF21235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21235_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 5e-44; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 32959230 - 32959136
Alignment:
| Q |
19 |
aagacccacttgtgacacttatcagatgcaactttccccattaacctgttccaaaacaaaatacacccaatcataacatagtacaaagaacaaga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32959230 |
aagacccacttgtgacacttatcagatgcaactttccccatcaacctgttccaaaacaaaatacacccaatcataacatagtacaaagaacaaga |
32959136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 152 - 258
Target Start/End: Complemental strand, 32959097 - 32958995
Alignment:
| Q |
152 |
atacagttaagatttaaacagtaactcccttcacatgctattggagacaacaagaatcagatagatagatagaaagagaaggagagagaataaaagcaca |
251 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32959097 |
atacagttaagatttaaacagtaactctcttcacatgctattggagacaacaagaatcagataga----tagaaagagaaggagagagaataaaagcaca |
32959002 |
T |
 |
| Q |
252 |
acatagt |
258 |
Q |
| |
|
||||||| |
|
|
| T |
32959001 |
acatagt |
32958995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 284 - 355
Target Start/End: Complemental strand, 32958961 - 32958890
Alignment:
| Q |
284 |
cctacccagtacccacccttctccataattatacagctgaatggacattttgctgaaagcttttctcacagg |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958961 |
cctacccagtacccacccttctccataattatacagctgaatggacattttgctgaaagcttttctcacagg |
32958890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University