View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21235_low_23 (Length: 364)

Name: NF21235_low_23
Description: NF21235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21235_low_23
NF21235_low_23
[»] chr6 (4 HSPs)
chr6 (156-347)||(2811719-2811917)
chr6 (17-122)||(2811901-2812006)
chr6 (28-71)||(2806471-2806514)
chr6 (28-71)||(8132683-8132726)


Alignment Details
Target: chr6 (Bit Score: 134; Significance: 1e-69; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 156 - 347
Target Start/End: Complemental strand, 2811917 - 2811719
Alignment:
156 aaatagattcaaagaaattgaacactgagaagtgagaggatgagagaagctttggtgtgtaaatttataggcaaggttgtgaatgactagttg-----tg 250  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||     ||    
2811917 aaatagattcaaagaaattgaacactgagaagtgagaggctgagagaagctt-ggtgtgtcaatttataggcaaggttgtgaatgactagttggtctttg 2811819  T
251 gatatttactattagcaccaccttcttttaatacaccctctcataaggtgtttgtcttttaatt---attaattgaataaagttagtgtctcacacaatt 347  Q
    |||||||||||||||||||||| ||| ||||||||||||||||||||||  |||||||||||||   |||||||||||||||||||||||||||||||||    
2811818 gatatttactattagcaccaccgtctattaatacaccctctcataaggtacttgtcttttaattattattaattgaataaagttagtgtctcacacaatt 2811719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 17 - 122
Target Start/End: Complemental strand, 2812006 - 2811901
Alignment:
17 cagagacttaattaaatactaggaatcatagaacaaatccatcatattgttgcagnnnnnnnctcatcaaatgattcattcaacaacgaaaatagattca 116  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||       ||||||||||||| ||||| | |||  |||||||||||    
2812006 cagagacttaattaaatactaggaatcatggaacaaatccatcatattgttgcagtttttttctcatcaaatgatccattccataacacaaatagattca 2811907  T
117 aagaaa 122  Q
    ||||||    
2811906 aagaaa 2811901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 28 - 71
Target Start/End: Complemental strand, 2806514 - 2806471
Alignment:
28 ttaaatactaggaatcatagaacaaatccatcatattgttgcag 71  Q
    |||||||||| ||||||| |||| ||||||||||||||||||||    
2806514 ttaaatactaagaatcatggaacgaatccatcatattgttgcag 2806471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 28 - 71
Target Start/End: Complemental strand, 8132726 - 8132683
Alignment:
28 ttaaatactaggaatcatagaacaaatccatcatattgttgcag 71  Q
    |||||||||||||||||| |||| |||||||| |||||||||||    
8132726 ttaaatactaggaatcatggaacgaatccatcgtattgttgcag 8132683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University