View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21235_low_28 (Length: 320)
Name: NF21235_low_28
Description: NF21235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21235_low_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 19 - 313
Target Start/End: Original strand, 30616532 - 30616822
Alignment:
| Q |
19 |
cctgcttggtttctccatgtcaaactgcaaaatgcaaatttcaaacaacaaacaataacaatctaaaactttgatacatctttcttaatcaaaaaattag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30616532 |
cctgcttggtttctccatgtcaaactgcaaaatgcaaatttcaaacaacaaacaataacaatctaaaactttgatacatctttcttaatcaaaaaattag |
30616631 |
T |
 |
| Q |
119 |
ttttgatcatnnnnnnnnnnnnnnncaatcacaatcttagtactattatattatttatgtttcatctttttgtatgatgctgtttaatggctagtatcct |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30616632 |
ttttgatcataaaaacaacaa----caatcacaatcttagtactattatattatttatgtttcatctttttgtatgatgctgtttaatggctagtatcct |
30616727 |
T |
 |
| Q |
219 |
tgtactcaaattagaattaaacttttccttttaattatgacaaaaaattcaaaatgcaaatatatatcaatgccaacaaatacttagaataatct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30616728 |
tgtactcaaattagaattaaacttttccttttaattatgacaaaaaattcaaaatgcaaatatatatcaatgccaacaaatacttagaattatct |
30616822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University