View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21235_low_42 (Length: 214)
Name: NF21235_low_42
Description: NF21235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21235_low_42 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 40192129 - 40192342
Alignment:
| Q |
1 |
atgattaagagataatcttctatattgagctggtgatcttccaacagaacaaaccataagtttattccaaatgaacctaaaaaactgaccaacaaaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40192129 |
atgattaagagataatcttctatattgagctggtgatcttccaacagaacaaaccataagtttattccaaatgaacctaaaaaactgaccaacaaaagat |
40192228 |
T |
|
| Q |
101 |
accctttgaagcataccatatttaacgtcaacctgaacaattttcctgcagagttgtgtcatcttcttggttgtttcttgaatcacttttgccattgaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40192229 |
accctttgaagcataccatatttaacgtcaacctgaacaattttcctgcagagttgtgtcatcttcttggttgtttcttgaatcacttttgccattgaga |
40192328 |
T |
|
| Q |
201 |
tatggctatgttct |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40192329 |
tatggctatgttct |
40192342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University