View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21235_low_43 (Length: 213)
Name: NF21235_low_43
Description: NF21235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21235_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 43705310 - 43705508
Alignment:
| Q |
1 |
acacaatttaaggcttaattaattgcaaatatataatgactgaacaattgcttgaagcttcattagctctcatgttaaagcaagaatcaaccttcaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43705310 |
acacaatttaaggcttaattaattgcaaatatataatgactgaacaattgcttgaagcttcattagctctcatgttaaagcaagaatcaaccttcaaatt |
43705409 |
T |
 |
| Q |
101 |
aaaaattggtagcgtaggtcatgtataaacattttcatatgctttcatccatgtctttacctttttgacccatgaagtcgtttattaaataatatatct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43705410 |
aaaaattggtagcgtaggtcatgtataaacattttcatatgctttcatccatgtctttacctttttgacccatgaagtcgtttattaaataatatatct |
43705508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 33 - 90
Target Start/End: Original strand, 43705599 - 43705656
Alignment:
| Q |
33 |
ataatgactgaacaattgcttgaagcttcattagctctcatgttaaagcaagaatcaa |
90 |
Q |
| |
|
||||||| ||||| ||||||||||| |||||||| ||||||| | ||| ||||||||| |
|
|
| T |
43705599 |
ataatgaatgaacgattgcttgaagtttcattagttctcatgcttaagtaagaatcaa |
43705656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University