View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21236_low_14 (Length: 270)
Name: NF21236_low_14
Description: NF21236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21236_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 256
Target Start/End: Original strand, 51931817 - 51932059
Alignment:
| Q |
11 |
caaaggaatgattgtatgactttattacttactcttggtgagggtaatctgcagttccatatgatatgcacagccttctctagttcttctcgaatttttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51931817 |
caaaggaatgattgtatgactttattacttactcttggtgagggtaatctgcagttccatatgatatgcacagccttctctagttcttctcgaatttttt |
51931916 |
T |
 |
| Q |
111 |
cattgtcctttggcctaagaataaaagtgaaaaggtcaggcaggattgttttggacttgcttgactgtaaacatgacatggatcactctaacttcaaaag |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51931917 |
cattgtcctttggcctaagaataaaagtgtaaaggtcaggcaggattgttttggacttgcttgactgtaaacatgacatggatcactctaacttcaaaag |
51932016 |
T |
 |
| Q |
211 |
cataataggaatgtcatcggtactatagccaaatattgaggctatt |
256 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
51932017 |
cataataggaatgtca---gtactatagccaaatattgaggctatt |
51932059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University