View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21237_high_10 (Length: 229)
Name: NF21237_high_10
Description: NF21237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21237_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 35551280 - 35551466
Alignment:
| Q |
17 |
attcccaacctattcctaaaggaatctaggtgccagaaatatcacaacgcgaggattgcagctgtttgttgcagcgaacatgtggaacgaccgtcgagat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35551280 |
attcccaacctattcctaaaggaatctaggtgccagaaatatcacaacgtgaggattgcagca-------------aacatgtggaacgaccgtcgagat |
35551366 |
T |
 |
| Q |
117 |
tcaccaacgatttattagttccctttaccttaccaatgttctatattttcctgttttttccttcaatgtcatttttgtgcctatactaactcagaataat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
35551367 |
tcaccaacgatttattagttccctttaccttaccaatgttctatattttcctgttttttccttcaatctcatttttgtgcctatactaacacagaataat |
35551466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 141
Target Start/End: Original strand, 19294223 - 19294326
Alignment:
| Q |
35 |
aaggaatctaggtgccagaaatatcacaacgcgaggattgcagctgtttgttgcagcgaacatgtggaacgaccgtcgagattcaccaacgatttattag |
134 |
Q |
| |
|
|||| ||| |||||||| ||||||||| | ||||||||||||||||||| ||||| || || ||||| |||||||||||| || || | ||||||| |
|
|
| T |
19294223 |
aagggatcgaggtgccacaaatatcacggcacgaggattgcagctgtttgctgcag---acgtgcggaacatccgtcgagattcgcccacaagttattag |
19294319 |
T |
 |
| Q |
135 |
ttccctt |
141 |
Q |
| |
|
||||||| |
|
|
| T |
19294320 |
ttccctt |
19294326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University